Background fluorescence problem

[simon walker (BI)-2]

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

Dear List,
We are imaging very weakly fluorescent live cells (expressing GFP) on a wide-
field system and having issues with a source of background fluorescence.  
When we look at our cells under epi-illumination we see a rapid drop in a weak
background signal (not where the cells are) that fully recovers over a ~10 s
period after the illumination light is switched off.  Our experiments require the
use of DMEM as the imaging medium and this is the likely cause of problem.  It
appears that something in the medium is sticking to the coverglass.  It's not
phenol red as the effect is seen with both phenol red-containing and phenol-
red-free DMEM.  Does anyone know what else it could be?  Has anyone else
seen anything similar?  We're wondering if it could be riboflavin which is in the
DMEM we're using.  Would this stick to glass?

I've seen that Life Technologies now market a substance that allegedly
surpresses background fluorescence in DMEM:
http://products.invitrogen.com/ivgn/product/R37603
Has anyone tried this?  Does anyone know how it works?

Thanks,
Simon

[mmodel]

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

We have kept cells successfully for long periods in a regular buffer with added glutamine and aminoacinds and/or vitamins. Various cocktails with aminoacids and vitamins are available from Sigma. You might try to experiment with those.

Mike

-----Original Message-----
From: Confocal Microscopy List [mailto:[hidden email]] On Behalf Of Simon Walker
Sent: Thursday, September 13, 2012 11:04 AM
To: [hidden email]
Subject: Background fluorescence problem

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

Dear List,
We are imaging very weakly fluorescent live cells (expressing GFP) on a wide-
field system and having issues with a source of background fluorescence.  
When we look at our cells under epi-illumination we see a rapid drop in a weak
background signal (not where the cells are) that fully recovers over a ~10 s
period after the illumination light is switched off.  Our experiments require the
use of DMEM as the imaging medium and this is the likely cause of problem.  It
appears that something in the medium is sticking to the coverglass.  It's not
phenol red as the effect is seen with both phenol red-containing and phenol-
red-free DMEM.  Does anyone know what else it could be?  Has anyone else
seen anything similar?  We're wondering if it could be riboflavin which is in the
DMEM we're using.  Would this stick to glass?

I've seen that Life Technologies now market a substance that allegedly
surpresses background fluorescence in DMEM:
http://products.invitrogen.com/ivgn/product/R37603
Has anyone tried this?  Does anyone know how it works?

Thanks,
Simon

[Glen MacDonald-2]

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

Dear Simon,
there are reports of autofluorescence arising from flavins and aromatic amino acids in culture media additives.  This apparently varies among different lots of additives.  these compounds have been also implicated in light-dependent toxicity.  Ch. 19 of The Handbook  mentions this, with some references.  

If the fluorescence recovers, I'd suspect that it is replenished by media circulation.
Regards,
Glen
Glen MacDonald
Cellular Morphology Core
Center for Human Development and Disability
Box 357920
University of Washington
Seattle, WA 98195-7920  USA
[phone]
[hidden email]


On Sep 13, 2012, at 8:04 AM, Simon Walker wrote:

> *****
> To join, leave or search the confocal microscopy listserv, go to:
> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
> *****
>
> Dear List,
> We are imaging very weakly fluorescent live cells (expressing GFP) on a wide-
> field system and having issues with a source of background fluorescence.  
> When we look at our cells under epi-illumination we see a rapid drop in a weak
> background signal (not where the cells are) that fully recovers over a ~10 s
> period after the illumination light is switched off.  Our experiments require the
> use of DMEM as the imaging medium and this is the likely cause of problem.  It
> appears that something in the medium is sticking to the coverglass.  It's not
> phenol red as the effect is seen with both phenol red-containing and phenol-
> red-free DMEM.  Does anyone know what else it could be?  Has anyone else
> seen anything similar?  We're wondering if it could be riboflavin which is in the
> DMEM we're using.  Would this stick to glass?
>
> I've seen that Life Technologies now market a substance that allegedly
> surpresses background fluorescence in DMEM:
> http://products.invitrogen.com/ivgn/product/R37603
> Has anyone tried this?  Does anyone know how it works?
>
> Thanks,
> Simon

[Kilgore, Jason-2]

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

** vendor reply **

Hi, Simon,

There are two options for commercial solutions:

The first one, which you mention, is the BackDrop background suppressor.  You would want the green one (to match the wavelength of your background signal -- the kit comes with blue, green, and red).  We have used it here at Molecular Probes to quench background fluorescence of this sort.  It's non-cell-permeant and non-toxic for standard imaging times.

The second option is to forego your media and instead image in our Live Cell Imaging Solution (catalog A14291DJ), which we routinely use now for most of our general imaging assays here.  It has been validated for signal-to-background for fluorescence for live cell imaging at ambient atmosphere and temperature for up to four hours with a wide range of cell lines.  It's a buffered salt solution with HEPES, as described in the product manual.
https://products.invitrogen.com/ivgn/product/A14291DJ
http://tools.invitrogen.com/content/sfs/manuals/Live_Cell_Imaging_Solution_QRC.pdf


Cheers,

Jason

Jason A. Kilgore
Technical Application Scientist
Molecular Probes Labeling and Detection Technologies
Cells Systems Division
 
T 1 800 955 6288 then option 4, then option 6,  or  541 335 0353 . F 541 335 0238
29851 Willow Creek Rd . Eugene . OR . 97402-9132 . United States
www.invitrogen.com/technicalsupport

 



-----Original Message-----
From: Confocal Microscopy List [mailto:[hidden email]] On Behalf Of Simon Walker
Sent: Thursday, September 13, 2012 8:04 AM
To: [hidden email]
Subject: Background fluorescence problem

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

Dear List,
We are imaging very weakly fluorescent live cells (expressing GFP) on a wide-
field system and having issues with a source of background fluorescence.  
When we look at our cells under epi-illumination we see a rapid drop in a weak
background signal (not where the cells are) that fully recovers over a ~10 s
period after the illumination light is switched off.  Our experiments require the
use of DMEM as the imaging medium and this is the likely cause of problem.  It
appears that something in the medium is sticking to the coverglass.  It's not
phenol red as the effect is seen with both phenol red-containing and phenol-
red-free DMEM.  Does anyone know what else it could be?  Has anyone else
seen anything similar?  We're wondering if it could be riboflavin which is in the
DMEM we're using.  Would this stick to glass?

I've seen that Life Technologies now market a substance that allegedly
surpresses background fluorescence in DMEM:
http://products.invitrogen.com/ivgn/product/R37603
Has anyone tried this?  Does anyone know how it works?

Thanks,
Simon

[George McNamara]

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

Hi Simon,

likely riboflavin and possibly other flavins. See
http://www.evrogen.com/products/medium_DMEM_gfp/medium_DMEM_gfp.shtml 
and the Bogdanov et al paper referenced  at the bottom of the page;

    * Bogdanov AM, Bogdanova EA, Chudakov DM, Gorodnicheva TV, Lukyanov
      S, Lukyanov KA. Cell culture medium affects GFP photostability: a
      solution. Nat Methods. 2009; 6 (12):859-60. / pmid: 19935837
      <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=19935837&dopt=Abstract>


Their solution: incubate cells in miedia without (or with low, if
needed) riboflavin for a day.

As a bonus, riboflavin quenches (FRET?) and/or transiently photoconverts
GFP to red fluorescence (might be mostly dark states):

Condensed mitotic chromosome structure at nanometer resolution using
PALM and EGFP- histones. </pubmed/20856676>* Matsuda* A, Shao L,
Boulanger J, Kervrann C, Carlton PM, Kner P, Agard D, *Sedat* JW. PLoS
One. 2010 Sep 15;5(9):e12768. PMID: 20856676


If you contact Essen Biosciences, they will (hopefully) give you a copy
of their application note on the concentrations of riboflavin in many
culture media and correlation with fluorescence of those media. Speaking
of Essen - they finally introduced a dual green+red fluorescence Incucyte.

Enjoy,

George



On 9/13/2012 11:04 AM, Simon Walker wrote:

> *****
> To join, leave or search the confocal microscopy listserv, go to:
> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
> *****
>
> Dear List,
> We are imaging very weakly fluorescent live cells (expressing GFP) on a wide-
> field system and having issues with a source of background fluorescence.
> When we look at our cells under epi-illumination we see a rapid drop in a weak
> background signal (not where the cells are) that fully recovers over a ~10 s
> period after the illumination light is switched off.  Our experiments require the
> use of DMEM as the imaging medium and this is the likely cause of problem.  It
> appears that something in the medium is sticking to the coverglass.  It's not
> phenol red as the effect is seen with both phenol red-containing and phenol-
> red-free DMEM.  Does anyone know what else it could be?  Has anyone else
> seen anything similar?  We're wondering if it could be riboflavin which is in the
> DMEM we're using.  Would this stick to glass?
>
> I've seen that Life Technologies now market a substance that allegedly
> surpresses background fluorescence in DMEM:
> http://products.invitrogen.com/ivgn/product/R37603
> Has anyone tried this?  Does anyone know how it works?
>
> Thanks,
> Simon
>
>    

[simon walker (BI)-2]

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

Thanks for the various responses.  Yes, I'd seen the Bogdanov paper and the Evrogen medium and thought that might be worth a try.  The problem we have is that for our assay the culture medium is absolutely critical (it's not just a case of keeping cells alive), so we can't use a minimal HEPES-based buffer.  I am interested to know what is in the 'BackDrop' solution.  We can't use it unless we're fairly confident it's not going to affect our assay.
Simon


-----Original Message-----
From: Confocal Microscopy List [mailto:[hidden email]] On Behalf Of George McNamara
Sent: 14 September 2012 01:57
To: [hidden email]
Subject: Re: Background fluorescence problem

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

Hi Simon,

likely riboflavin and possibly other flavins. See http://www.evrogen.com/products/medium_DMEM_gfp/medium_DMEM_gfp.shtml
and the Bogdanov et al paper referenced  at the bottom of the page;

    * Bogdanov AM, Bogdanova EA, Chudakov DM, Gorodnicheva TV, Lukyanov
      S, Lukyanov KA. Cell culture medium affects GFP photostability: a
      solution. Nat Methods. 2009; 6 (12):859-60. / pmid: 19935837
      <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=19935837&dopt=Abstract>


Their solution: incubate cells in miedia without (or with low, if
needed) riboflavin for a day.

As a bonus, riboflavin quenches (FRET?) and/or transiently photoconverts GFP to red fluorescence (might be mostly dark states):

Condensed mitotic chromosome structure at nanometer resolution using PALM and EGFP- histones. </pubmed/20856676>* Matsuda* A, Shao L, Boulanger J, Kervrann C, Carlton PM, Kner P, Agard D, *Sedat* JW. PLoS One. 2010 Sep 15;5(9):e12768. PMID: 20856676


If you contact Essen Biosciences, they will (hopefully) give you a copy of their application note on the concentrations of riboflavin in many culture media and correlation with fluorescence of those media. Speaking of Essen - they finally introduced a dual green+red fluorescence Incucyte.

Enjoy,

George



On 9/13/2012 11:04 AM, Simon Walker wrote:

> *****
> To join, leave or search the confocal microscopy listserv, go to:
> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
> *****
>
> Dear List,
> We are imaging very weakly fluorescent live cells (expressing GFP) on
> a wide- field system and having issues with a source of background fluorescence.
> When we look at our cells under epi-illumination we see a rapid drop
> in a weak background signal (not where the cells are) that fully
> recovers over a ~10 s period after the illumination light is switched
> off.  Our experiments require the use of DMEM as the imaging medium
> and this is the likely cause of problem.  It appears that something in
> the medium is sticking to the coverglass.  It's not phenol red as the
> effect is seen with both phenol red-containing and phenol- red-free
> DMEM.  Does anyone know what else it could be?  Has anyone else seen
> anything similar?  We're wondering if it could be riboflavin which is in the DMEM we're using.  Would this stick to glass?
>
> I've seen that Life Technologies now market a substance that allegedly
> surpresses background fluorescence in DMEM:
> http://products.invitrogen.com/ivgn/product/R37603
> Has anyone tried this?  Does anyone know how it works?
>
> Thanks,
> Simon
>
>

The Babraham Institute, Babraham Research Campus, Cambridge CB22 3AT Registered Charity No. 1053902.
The information transmitted in this email is directed only to the addressee. If you received this in error, please contact the sender and delete this email from your system. The contents of this e-mail are the views of the sender and do not necessarily represent the views of the Babraham Institute. Full conditions at: www.babraham.ac.uk<http://www.babraham.ac.uk/email_disclaimer.html>

[George McNamara]

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

Hi Simon,

Your cells might not need the 100x excess of riboflavin present in
"standard" DMEM, your background could be reduced. The Essen tech note I
mentioned lists:
DMEM 0.4 mg/L riboflavin ... 43.6 units fluorescence
Eagles MEM 0.1 mg/mL     ... 12.9
F12K            0.04               ... 5.4
EBM             0.004             ... 3.7
Riboflavin (alone) 0.4          ... 58.7 (perhaps suggesting that
culture media quenches riboflavin or it gets converted in part to
something less fluorescent?)
Contact Essen if you want the entire tech note.


If you absolutely require a green fluorescent protein, spend the time to
switch to the new Clover or "V6" from Steven Vogel (available from
addgene.org as VVVVVV).
If you do not need green, switch to tdTomato or the new mRuby2.



Choose Destination

    * File
    * Clipboard
    * Collections
    * E-mail
    * Order
    * My Bibliography
    * Citation manager

    * Format

Create File

    * Search: clover mruby2
    * Format MeSH and Other Data
    * E-mail
    * Subject
    * Additional text

E-mail
"SPAM" filtering software notice
</corehtml/query/MyNCBI/exquery/spam_note.html>
Add to Clipboard
Add to Collections
Order articles
Add to My Bibliography

Generate a file for use with external citation management software.

Create File
Nat Methods. <#> 2012 Sep 9. doi: 10.1038/nmeth.2171. [Epub ahead of print]


  Improving FRET dynamic range with bright green and red fluorescent
  proteins.

Lam AJ
</pubmed?term=Lam%20AJ%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
St-Pierre F
</pubmed?term=St-Pierre%20F%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
Gong Y
</pubmed?term=Gong%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
Marshall JD
</pubmed?term=Marshall%20JD%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
Cranfill PJ
</pubmed?term=Cranfill%20PJ%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
Baird MA
</pubmed?term=Baird%20MA%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
McKeown MR
</pubmed?term=McKeown%20MR%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
Wiedenmann J
</pubmed?term=Wiedenmann%20J%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
Davidson MW
</pubmed?term=Davidson%20MW%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
Schnitzer MJ
</pubmed?term=Schnitzer%20MJ%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
Tsien RY
</pubmed?term=Tsien%20RY%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
Lin MZ
</pubmed?term=Lin%20MZ%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>.


      Source

1] Department of Bioengineering, Stanford University, Stanford,
California, USA. [2] Department of Pediatrics, Stanford University,
Stanford, California, USA.


      Abstract

A variety of genetically encoded reporters use changes in fluorescence
resonance energy transfer (FRET) to report on biochemical processes in
living cells. The standard genetically encoded FRET pair consists of
CFPs and YFPs, but many CFP-YFP reporters suffer from low FRET dynamic
range, phototoxicity from the CFP excitation light and complex
photokinetic events such as reversible photobleaching and
photoconversion. We engineered two fluorescent proteins,* Clover and
mRuby2*, which are the brightest green and red fluorescent proteins to
date and have the highest Förster radius of any ratiometric FRET pair
yet described. Replacement of CFP and YFP with these two proteins in
reporters of kinase activity, small GTPase activity and transmembrane
voltage significantly improves photostability, FRET dynamic range and
emission ratio changes. These improvements enhance detection of
transient biochemical events such as neuronal action-potential firing
and RhoA activation in growth cones.

PMID:
    22961245


PLoS One. <#> 2012;7(5):e38209. Epub 2012 May 30.


  Fluorescence polarization and fluctuation analysis monitors subunit
  proximity, stoichiometry, and protein complex hydrodynamics.

Nguyen TA
</pubmed?term=Nguyen%20TA%5BAuthor%5D&cauthor=true&cauthor_uid=22666486>, Sarkar
P
</pubmed?term=Sarkar%20P%5BAuthor%5D&cauthor=true&cauthor_uid=22666486>,
Veetil JV
</pubmed?term=Veetil%20JV%5BAuthor%5D&cauthor=true&cauthor_uid=22666486>, Koushik
SV
</pubmed?term=Koushik%20SV%5BAuthor%5D&cauthor=true&cauthor_uid=22666486>,
Vogel SS
</pubmed?term=Vogel%20SS%5BAuthor%5D&cauthor=true&cauthor_uid=22666486>.


      Source

Section on Cellular Biophotonics, Laboratory of Molecular Physiology,
National Institute on Alcohol Abuse and Alcoholism, National Institutes
of Health, Rockville, Maryland, United States of America.


      Abstract

Förster resonance energy transfer (FRET) microscopy is frequently used
to study protein interactions and conformational changes in living
cells. The utility of FRET is limited by false positive and negative
signals. To overcome these limitations we have developed Fluorescence
Polarization and Fluctuation Analysis (FPFA), a hybrid single-molecule
based method combining time-resolved fluorescence anisotropy (homo-FRET)
and fluorescence correlation spectroscopy. Using FPFA, homo-FRET (a 1-10
nm proximity gauge), brightness (a measure of the number of fluorescent
subunits in a complex), and correlation time (an attribute sensitive to
the mass and shape of a protein complex) can be simultaneously measured.
These measurements together rigorously constrain the interpretation of
FRET signals. Venus based control-constructs were used to validate FPFA.
The utility of FPFA was demonstrated by measuring in living cells the
number of subunits in the ?-isoform of Venus-tagged calcium-calmodulin
dependent protein kinase-II (CaMKII?) holoenzyme. Brightness analysis
revealed that the holoenzyme has, on average, 11.9 ± 1.2 subunit, but
values ranged from 10-14 in individual cells. Homo-FRET analysis
simultaneously detected that catalytic domains were arranged as dimers
in the dodecameric holoenzyme, and this paired organization was
confirmed by quantitative hetero-FRET analysis. In freshly prepared cell
homogenates FPFA detected only 10.2 ± 1.3 subunits in the holoenzyme
with values ranging from 9-12. Despite the reduction in subunit number,
catalytic domains were still arranged as pairs in homogenates. Thus,
FPFA suggests that while the absolute number of subunits in an
auto-inhibited holoenzyme might vary from cell to cell, the organization
of catalytic domains into pairs is preserved.

PMID:
    22666486


I am a bit disappointed Vogel's group did not go for V8 (a well known
drink) or V12 - the latter either as a polypeptide or with inducible
dimerization domain. V12 since the goal of this paper is to quantify the
number of subunits in CaMKIIalpha, which turns out to be 12 (+/- a few)
as described in
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3364239/figure/pone-0038209-g004/ 


On 9/14/2012 4:32 AM, simon walker wrote:

> *****
> To join, leave or search the confocal microscopy listserv, go to:
> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
> *****
>
> Thanks for the various responses.  Yes, I'd seen the Bogdanov paper and the Evrogen medium and thought that might be worth a try.  The problem we have is that for our assay the culture medium is absolutely critical (it's not just a case of keeping cells alive), so we can't use a minimal HEPES-based buffer.  I am interested to know what is in the 'BackDrop' solution.  We can't use it unless we're fairly confident it's not going to affect our assay.
> Simon
>
>
> -----Original Message-----
> From: Confocal Microscopy List [mailto:[hidden email]] On Behalf Of George McNamara
> Sent: 14 September 2012 01:57
> To: [hidden email]
> Subject: Re: Background fluorescence problem
>
> *****
> To join, leave or search the confocal microscopy listserv, go to:
> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
> *****
>
> Hi Simon,
>
> likely riboflavin and possibly other flavins. See http://www.evrogen.com/products/medium_DMEM_gfp/medium_DMEM_gfp.shtml
> and the Bogdanov et al paper referenced  at the bottom of the page;
>
>      * Bogdanov AM, Bogdanova EA, Chudakov DM, Gorodnicheva TV, Lukyanov
>        S, Lukyanov KA. Cell culture medium affects GFP photostability: a
>        solution. Nat Methods. 2009; 6 (12):859-60. / pmid: 19935837
>        <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=19935837&dopt=Abstract>
>
>
> Their solution: incubate cells in miedia without (or with low, if
> needed) riboflavin for a day.
>
> As a bonus, riboflavin quenches (FRET?) and/or transiently photoconverts GFP to red fluorescence (might be mostly dark states):
>
> Condensed mitotic chromosome structure at nanometer resolution using PALM and EGFP- histones.</pubmed/20856676>* Matsuda* A, Shao L, Boulanger J, Kervrann C, Carlton PM, Kner P, Agard D, *Sedat* JW. PLoS One. 2010 Sep 15;5(9):e12768. PMID: 20856676
>
>
> If you contact Essen Biosciences, they will (hopefully) give you a copy of their application note on the concentrations of riboflavin in many culture media and correlation with fluorescence of those media. Speaking of Essen - they finally introduced a dual green+red fluorescence Incucyte.
>
> Enjoy,
>
> George
>
>
>
> On 9/13/2012 11:04 AM, Simon Walker wrote:
>    
>> *****
>> To join, leave or search the confocal microscopy listserv, go to:
>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> *****
>>
>> Dear List,
>> We are imaging very weakly fluorescent live cells (expressing GFP) on
>> a wide- field system and having issues with a source of background fluorescence.
>> When we look at our cells under epi-illumination we see a rapid drop
>> in a weak background signal (not where the cells are) that fully
>> recovers over a ~10 s period after the illumination light is switched
>> off.  Our experiments require the use of DMEM as the imaging medium
>> and this is the likely cause of problem.  It appears that something in
>> the medium is sticking to the coverglass.  It's not phenol red as the
>> effect is seen with both phenol red-containing and phenol- red-free
>> DMEM.  Does anyone know what else it could be?  Has anyone else seen
>> anything similar?  We're wondering if it could be riboflavin which is in the DMEM we're using.  Would this stick to glass?
>>
>> I've seen that Life Technologies now market a substance that allegedly
>> surpresses background fluorescence in DMEM:
>> http://products.invitrogen.com/ivgn/product/R37603
>> Has anyone tried this?  Does anyone know how it works?
>>
>> Thanks,
>> Simon
>>
>>
>>      
> The Babraham Institute, Babraham Research Campus, Cambridge CB22 3AT Registered Charity No. 1053902.
> The information transmitted in this email is directed only to the addressee. If you received this in error, please contact the sender and delete this email from your system. The contents of this e-mail are the views of the sender and do not necessarily represent the views of the Babraham Institute. Full conditions at: www.babraham.ac.uk<http://www.babraham.ac.uk/email_disclaimer.html>
>
>    

[Matt Kofron]

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

Have you tried a narrow YFP filter? A 500/20 excitation filter should still
excite GFP but shift away from the flavin peak. You will see less GFP, but
it might improve S/N.

[Mike Ignatius-2]

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

This issue has been discussed several times on the listserve - including
this commentary back in 2006 from Gert van Cappellen, which parallels what
George and others are saying and publishing:

"Regarding the autofluorescence of the medium . To our experience riboflavin
free medium helps more than phenol-red free medium. I've started out using
completely phenol red-free DMEM (you can get that from Gibco) to reduce
background fluorescence, but it didn't help at all. After that, I've spent
some time on a fluorometer to check out all the components of our culture
media and in the case of DMEM, riboflavin caused more than 95% of the
fluorescence! Phenol-red itself is NOT significantly fluorescent in the
wavelength range relevant to GFP."

In fact there is good evidence that Phenol Red is a good quencher, including
the flavins and whatever green signal one is trying to detect!  

Lelong and Rebel raise the additional concern that bicarbonate based buffers
can reach pH 8.5 in an hour if not maintained in CO2.

Lelong IH, Rebel G. (1998) "pH drift of "physiological buffers" and culture
media used for cell incubation during in vitro studies." J Pharmacol Toxicol
Methods 39(4):203-10

For applications where complete media is not essential (sorry Dr. Walker),
Marker Gene Technologies now offers a HEPES based buffer for imaging that:

I) provides minimal essential nutrients to keep cells metabolically
active with no autofluorescence.  
II) contains reagents (and shipped in a brown bottle) to avoid the
toxicity associated with HEPES exposure to light
III)  has a mild anti-oxidant for signal preservation.  
IV) maintains proper pH and osmolarity for hours without CO2.

Our PIS describes the product it in more detail @
http://www.markergene.com/ProductDetails.php/M1898

Mike

Mike Ignatius, Ph.D.
[hidden email]
Marker Gene Technologies Inc.
1850 Millrace Drive
Eugene,  Oregon, USA  97403
541 342 3760
markergene.com

-----Original Message-----
From: Confocal Microscopy List [mailto:[hidden email]] On
Behalf Of George McNamara
Sent: Thursday, September 13, 2012 5:57 PM
To: [hidden email]
Subject: Re: Background fluorescence problem

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

Hi Simon,

likely riboflavin and possibly other flavins. See
http://www.evrogen.com/products/medium_DMEM_gfp/medium_DMEM_gfp.shtml
and the Bogdanov et al paper referenced  at the bottom of the page;

    * Bogdanov AM, Bogdanova EA, Chudakov DM, Gorodnicheva TV, Lukyanov
      S, Lukyanov KA. Cell culture medium affects GFP photostability: a
      solution. Nat Methods. 2009; 6 (12):859-60. / pmid: 19935837
 
<http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_u
ids=19935837&dopt=Abstract>


Their solution: incubate cells in miedia without (or with low, if
needed) riboflavin for a day.

As a bonus, riboflavin quenches (FRET?) and/or transiently photoconverts GFP
to red fluorescence (might be mostly dark states):

Condensed mitotic chromosome structure at nanometer resolution using PALM
and EGFP- histones. </pubmed/20856676>* Matsuda* A, Shao L, Boulanger J,
Kervrann C, Carlton PM, Kner P, Agard D, *Sedat* JW. PLoS One. 2010 Sep
15;5(9):e12768. PMID: 20856676


If you contact Essen Biosciences, they will (hopefully) give you a copy of
their application note on the concentrations of riboflavin in many culture
media and correlation with fluorescence of those media. Speaking of Essen -
they finally introduced a dual green+red fluorescence Incucyte.

Enjoy,

George



On 9/13/2012 11:04 AM, Simon Walker wrote:
> *****
> To join, leave or search the confocal microscopy listserv, go to:
> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
> *****
>
> Dear List,
> We are imaging very weakly fluorescent live cells (expressing GFP) on
> a wide- field system and having issues with a source of background
fluorescence.
> When we look at our cells under epi-illumination we see a rapid drop
> in a weak background signal (not where the cells are) that fully
> recovers over a ~10 s period after the illumination light is switched
> off.  Our experiments require the use of DMEM as the imaging medium
> and this is the likely cause of problem.  It appears that something in
> the medium is sticking to the coverglass.  It's not phenol red as the
> effect is seen with both phenol red-containing and phenol- red-free
> DMEM.  Does anyone know what else it could be?  Has anyone else seen
> anything similar?  We're wondering if it could be riboflavin which is in
the DMEM we're using.  Would this stick to glass?

>
> I've seen that Life Technologies now market a substance that allegedly
> surpresses background fluorescence in DMEM:
> http://products.invitrogen.com/ivgn/product/R37603
> Has anyone tried this?  Does anyone know how it works?
>
> Thanks,
> Simon
>
>    

[Kilgore, Jason-2]

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

** vendor reply **

Hi, Simon,

Backdrop reagents are dye-based quenchers in a buffer solution.  Beyond that, unfortunately, the identity of the components is proprietary.

We haven't heard of any problems with its use for live cell assays, with the exception, of course, of assays that require a dye in the extracellular media or on the cell surface in the same wavelength (which would contact the quencher dye).

Jason

Jason A. Kilgore
Technical Application Scientist
Molecular Probes Labeling and Detection Technologies
Cells Systems Division
 
T 1 800 955 6288 then option 4, then option 6,  or  541 335 0353 . F 541 335 0238
29851 Willow Creek Rd . Eugene . OR . 97402-9132 . United States
www.invitrogen.com/technicalsupport

 
-----Original Message-----
From: Confocal Microscopy List [mailto:[hidden email]] On Behalf Of simon walker
Sent: Friday, September 14, 2012 1:32 AM
To: [hidden email]
Subject: Re: Background fluorescence problem

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

Thanks for the various responses.  Yes, I'd seen the Bogdanov paper and the Evrogen medium and thought that might be worth a try.  The problem we have is that for our assay the culture medium is absolutely critical (it's not just a case of keeping cells alive), so we can't use a minimal HEPES-based buffer.  I am interested to know what is in the 'BackDrop' solution.  We can't use it unless we're fairly confident it's not going to affect our assay.
Simon


-----Original Message-----
From: Confocal Microscopy List [mailto:[hidden email]] On Behalf Of George McNamara
Sent: 14 September 2012 01:57
To: [hidden email]
Subject: Re: Background fluorescence problem

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

Hi Simon,

likely riboflavin and possibly other flavins. See http://www.evrogen.com/products/medium_DMEM_gfp/medium_DMEM_gfp.shtml
and the Bogdanov et al paper referenced  at the bottom of the page;

    * Bogdanov AM, Bogdanova EA, Chudakov DM, Gorodnicheva TV, Lukyanov
      S, Lukyanov KA. Cell culture medium affects GFP photostability: a
      solution. Nat Methods. 2009; 6 (12):859-60. / pmid: 19935837
      <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=19935837&dopt=Abstract>


Their solution: incubate cells in miedia without (or with low, if
needed) riboflavin for a day.

As a bonus, riboflavin quenches (FRET?) and/or transiently photoconverts GFP to red fluorescence (might be mostly dark states):

Condensed mitotic chromosome structure at nanometer resolution using PALM and EGFP- histones. </pubmed/20856676>* Matsuda* A, Shao L, Boulanger J, Kervrann C, Carlton PM, Kner P, Agard D, *Sedat* JW. PLoS One. 2010 Sep 15;5(9):e12768. PMID: 20856676


If you contact Essen Biosciences, they will (hopefully) give you a copy of their application note on the concentrations of riboflavin in many culture media and correlation with fluorescence of those media. Speaking of Essen - they finally introduced a dual green+red fluorescence Incucyte.

Enjoy,

George



On 9/13/2012 11:04 AM, Simon Walker wrote:

> *****
> To join, leave or search the confocal microscopy listserv, go to:
> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
> *****
>
> Dear List,
> We are imaging very weakly fluorescent live cells (expressing GFP) on
> a wide- field system and having issues with a source of background fluorescence.
> When we look at our cells under epi-illumination we see a rapid drop
> in a weak background signal (not where the cells are) that fully
> recovers over a ~10 s period after the illumination light is switched
> off.  Our experiments require the use of DMEM as the imaging medium
> and this is the likely cause of problem.  It appears that something in
> the medium is sticking to the coverglass.  It's not phenol red as the
> effect is seen with both phenol red-containing and phenol- red-free
> DMEM.  Does anyone know what else it could be?  Has anyone else seen
> anything similar?  We're wondering if it could be riboflavin which is in the DMEM we're using.  Would this stick to glass?
>
> I've seen that Life Technologies now market a substance that allegedly
> surpresses background fluorescence in DMEM:
> http://products.invitrogen.com/ivgn/product/R37603
> Has anyone tried this?  Does anyone know how it works?
>
> Thanks,
> Simon
>
>

The Babraham Institute, Babraham Research Campus, Cambridge CB22 3AT Registered Charity No. 1053902.
The information transmitted in this email is directed only to the addressee. If you received this in error, please contact the sender and delete this email from your system. The contents of this e-mail are the views of the sender and do not necessarily represent the views of the Babraham Institute. Full conditions at: www.babraham.ac.uk<http://www.babraham.ac.uk/email_disclaimer.html>

[Kurt Thorn]

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

What is Clover GFP? I can't find much information about it on Google.

Thanks,
Kurt

On 9/14/2012 3:49 AM, George McNamara wrote:

> *****
> To join, leave or search the confocal microscopy listserv, go to:
> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
> *****
>
> Hi Simon,
>
> Your cells might not need the 100x excess of riboflavin present in
> "standard" DMEM, your background could be reduced. The Essen tech note
> I mentioned lists:
> DMEM 0.4 mg/L riboflavin ... 43.6 units fluorescence
> Eagles MEM 0.1 mg/mL     ... 12.9
> F12K            0.04               ... 5.4
> EBM             0.004             ... 3.7
> Riboflavin (alone) 0.4          ... 58.7 (perhaps suggesting that
> culture media quenches riboflavin or it gets converted in part to
> something less fluorescent?)
> Contact Essen if you want the entire tech note.
>
>
> If you absolutely require a green fluorescent protein, spend the time
> to switch to the new Clover or "V6" from Steven Vogel (available from
> addgene.org as VVVVVV).
> If you do not need green, switch to tdTomato or the new mRuby2.
>
>
>
> Choose Destination
>
>    * File
>    * Clipboard
>    * Collections
>    * E-mail
>    * Order
>    * My Bibliography
>    * Citation manager
>
>    * Format
>
> Create File
>
>    * Search: clover mruby2
>    * Format MeSH and Other Data
>    * E-mail
>    * Subject
>    * Additional text
>
> E-mail
> "SPAM" filtering software notice
> </corehtml/query/MyNCBI/exquery/spam_note.html>
> Add to Clipboard
> Add to Collections
> Order articles
> Add to My Bibliography
>
> Generate a file for use with external citation management software.
>
> Create File
> Nat Methods. <#> 2012 Sep 9. doi: 10.1038/nmeth.2171. [Epub ahead of
> print]
>
>
>  Improving FRET dynamic range with bright green and red fluorescent
>  proteins.
>
> Lam AJ
> </pubmed?term=Lam%20AJ%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
> St-Pierre F
> </pubmed?term=St-Pierre%20F%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
> Gong Y
> </pubmed?term=Gong%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
> Marshall JD
> </pubmed?term=Marshall%20JD%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
> Cranfill PJ
> </pubmed?term=Cranfill%20PJ%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
> Baird MA
> </pubmed?term=Baird%20MA%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
> McKeown MR
> </pubmed?term=McKeown%20MR%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
> Wiedenmann J
> </pubmed?term=Wiedenmann%20J%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
> Davidson MW
> </pubmed?term=Davidson%20MW%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
> Schnitzer MJ
> </pubmed?term=Schnitzer%20MJ%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
> Tsien RY
> </pubmed?term=Tsien%20RY%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
> Lin MZ
> </pubmed?term=Lin%20MZ%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>.
>
>
>      Source
>
> 1] Department of Bioengineering, Stanford University, Stanford,
> California, USA. [2] Department of Pediatrics, Stanford University,
> Stanford, California, USA.
>
>
>      Abstract
>
> A variety of genetically encoded reporters use changes in fluorescence
> resonance energy transfer (FRET) to report on biochemical processes in
> living cells. The standard genetically encoded FRET pair consists of
> CFPs and YFPs, but many CFP-YFP reporters suffer from low FRET dynamic
> range, phototoxicity from the CFP excitation light and complex
> photokinetic events such as reversible photobleaching and
> photoconversion. We engineered two fluorescent proteins,* Clover and
> mRuby2*, which are the brightest green and red fluorescent proteins to
> date and have the highest Förster radius of any ratiometric FRET pair
> yet described. Replacement of CFP and YFP with these two proteins in
> reporters of kinase activity, small GTPase activity and transmembrane
> voltage significantly improves photostability, FRET dynamic range and
> emission ratio changes. These improvements enhance detection of
> transient biochemical events such as neuronal action-potential firing
> and RhoA activation in growth cones.
>
> PMID:
>    22961245
>
>
> PLoS One. <#> 2012;7(5):e38209. Epub 2012 May 30.
>
>
>  Fluorescence polarization and fluctuation analysis monitors subunit
>  proximity, stoichiometry, and protein complex hydrodynamics.
>
> Nguyen TA
> </pubmed?term=Nguyen%20TA%5BAuthor%5D&cauthor=true&cauthor_uid=22666486>,
> Sarkar P
> </pubmed?term=Sarkar%20P%5BAuthor%5D&cauthor=true&cauthor_uid=22666486>,
> Veetil JV
> </pubmed?term=Veetil%20JV%5BAuthor%5D&cauthor=true&cauthor_uid=22666486>,
> Koushik SV
> </pubmed?term=Koushik%20SV%5BAuthor%5D&cauthor=true&cauthor_uid=22666486>,
> Vogel SS
> </pubmed?term=Vogel%20SS%5BAuthor%5D&cauthor=true&cauthor_uid=22666486>.
>
>
>      Source
>
> Section on Cellular Biophotonics, Laboratory of Molecular Physiology,
> National Institute on Alcohol Abuse and Alcoholism, National
> Institutes of Health, Rockville, Maryland, United States of America.
>
>
>      Abstract
>
> Förster resonance energy transfer (FRET) microscopy is frequently used
> to study protein interactions and conformational changes in living
> cells. The utility of FRET is limited by false positive and negative
> signals. To overcome these limitations we have developed Fluorescence
> Polarization and Fluctuation Analysis (FPFA), a hybrid single-molecule
> based method combining time-resolved fluorescence anisotropy
> (homo-FRET) and fluorescence correlation spectroscopy. Using FPFA,
> homo-FRET (a 1-10 nm proximity gauge), brightness (a measure of the
> number of fluorescent subunits in a complex), and correlation time (an
> attribute sensitive to the mass and shape of a protein complex) can be
> simultaneously measured. These measurements together rigorously
> constrain the interpretation of FRET signals. Venus based
> control-constructs were used to validate FPFA. The utility of FPFA was
> demonstrated by measuring in living cells the number of subunits in
> the ?-isoform of Venus-tagged calcium-calmodulin dependent protein
> kinase-II (CaMKII?) holoenzyme. Brightness analysis revealed that the
> holoenzyme has, on average, 11.9 ± 1.2 subunit, but values ranged from
> 10-14 in individual cells. Homo-FRET analysis simultaneously detected
> that catalytic domains were arranged as dimers in the dodecameric
> holoenzyme, and this paired organization was confirmed by quantitative
> hetero-FRET analysis. In freshly prepared cell homogenates FPFA
> detected only 10.2 ± 1.3 subunits in the holoenzyme with values
> ranging from 9-12. Despite the reduction in subunit number, catalytic
> domains were still arranged as pairs in homogenates. Thus, FPFA
> suggests that while the absolute number of subunits in an
> auto-inhibited holoenzyme might vary from cell to cell, the
> organization of catalytic domains into pairs is preserved.
>
> PMID:
>    22666486
>
>
> I am a bit disappointed Vogel's group did not go for V8 (a well known
> drink) or V12 - the latter either as a polypeptide or with inducible
> dimerization domain. V12 since the goal of this paper is to quantify
> the number of subunits in CaMKIIalpha, which turns out to be 12 (+/- a
> few) as described in
> http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3364239/figure/pone-0038209-g004/
>
>
> On 9/14/2012 4:32 AM, simon walker wrote:
>> *****
>> To join, leave or search the confocal microscopy listserv, go to:
>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> *****
>>
>> Thanks for the various responses.  Yes, I'd seen the Bogdanov paper
>> and the Evrogen medium and thought that might be worth a try.  The
>> problem we have is that for our assay the culture medium is
>> absolutely critical (it's not just a case of keeping cells alive), so
>> we can't use a minimal HEPES-based buffer.  I am interested to know
>> what is in the 'BackDrop' solution.  We can't use it unless we're
>> fairly confident it's not going to affect our assay.
>> Simon
>>
>>
>> -----Original Message-----
>> From: Confocal Microscopy List
>> [mailto:[hidden email]] On Behalf Of George McNamara
>> Sent: 14 September 2012 01:57
>> To: [hidden email]
>> Subject: Re: Background fluorescence problem
>>
>> *****
>> To join, leave or search the confocal microscopy listserv, go to:
>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> *****
>>
>> Hi Simon,
>>
>> likely riboflavin and possibly other flavins. See
>> http://www.evrogen.com/products/medium_DMEM_gfp/medium_DMEM_gfp.shtml
>> and the Bogdanov et al paper referenced  at the bottom of the page;
>>
>>      * Bogdanov AM, Bogdanova EA, Chudakov DM, Gorodnicheva TV, Lukyanov
>>        S, Lukyanov KA. Cell culture medium affects GFP photostability: a
>>        solution. Nat Methods. 2009; 6 (12):859-60. / pmid: 19935837
>> <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=19935837&dopt=Abstract>
>>
>>
>> Their solution: incubate cells in miedia without (or with low, if
>> needed) riboflavin for a day.
>>
>> As a bonus, riboflavin quenches (FRET?) and/or transiently
>> photoconverts GFP to red fluorescence (might be mostly dark states):
>>
>> Condensed mitotic chromosome structure at nanometer resolution using
>> PALM and EGFP- histones.</pubmed/20856676>* Matsuda* A, Shao L,
>> Boulanger J, Kervrann C, Carlton PM, Kner P, Agard D, *Sedat* JW.
>> PLoS One. 2010 Sep 15;5(9):e12768. PMID: 20856676
>>
>>
>> If you contact Essen Biosciences, they will (hopefully) give you a
>> copy of their application note on the concentrations of riboflavin in
>> many culture media and correlation with fluorescence of those media.
>> Speaking of Essen - they finally introduced a dual green+red
>> fluorescence Incucyte.
>>
>> Enjoy,
>>
>> George
>>
>>
>>
>> On 9/13/2012 11:04 AM, Simon Walker wrote:
>>> *****
>>> To join, leave or search the confocal microscopy listserv, go to:
>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>> *****
>>>
>>> Dear List,
>>> We are imaging very weakly fluorescent live cells (expressing GFP) on
>>> a wide- field system and having issues with a source of background
>>> fluorescence.
>>> When we look at our cells under epi-illumination we see a rapid drop
>>> in a weak background signal (not where the cells are) that fully
>>> recovers over a ~10 s period after the illumination light is switched
>>> off.  Our experiments require the use of DMEM as the imaging medium
>>> and this is the likely cause of problem.  It appears that something in
>>> the medium is sticking to the coverglass.  It's not phenol red as the
>>> effect is seen with both phenol red-containing and phenol- red-free
>>> DMEM.  Does anyone know what else it could be?  Has anyone else seen
>>> anything similar?  We're wondering if it could be riboflavin which
>>> is in the DMEM we're using.  Would this stick to glass?
>>>
>>> I've seen that Life Technologies now market a substance that allegedly
>>> surpresses background fluorescence in DMEM:
>>> http://products.invitrogen.com/ivgn/product/R37603
>>> Has anyone tried this?  Does anyone know how it works?
>>>
>>> Thanks,
>>> Simon
>>>
>>>
>> The Babraham Institute, Babraham Research Campus, Cambridge CB22 3AT
>> Registered Charity No. 1053902.
>> The information transmitted in this email is directed only to the
>> addressee. If you received this in error, please contact the sender
>> and delete this email from your system. The contents of this e-mail
>> are the views of the sender and do not necessarily represent the
>> views of the Babraham Institute. Full conditions at:
>> www.babraham.ac.uk<http://www.babraham.ac.uk/email_disclaimer.html>
>>
>
>

[George McNamara]

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

Hi Kurt,

Clover and mruby2 are described in the Lam et al paper at Nature Methods

http://www.nature.com/nmeth/journal/vaop/ncurrent/full/nmeth.2171.html

A variety of genetically encoded reporters use changes in fluorescence
(or Förster) resonance energy transfer (FRET) to report on biochemical
processes in living cells. The standard genetically encoded FRET pair
consists of CFPs and YFPs, but many CFP-YFP reporters suffer from low
FRET dynamic range, phototoxicity from the CFP excitation light and
complex photokinetic events such as reversible photobleaching and
photoconversion. We engineered two fluorescent proteins, Clover and
mRuby2, which are the brightest green and red fluorescent proteins to
date and have the highest Förster radius of any ratiometric FRET pair
yet described. Replacement of CFP and YFP with these two proteins in
reporters of kinase activity, small GTPase activity and transmembrane
voltage significantly improves photostability, FRET dynamic range and
emission ratio changes. These improvements enhance detection of
transient biochemical events such as neuronal action-potential firing
and RhoA activation in growth cones.



On 9/14/2012 2:58 PM, Kurt Thorn wrote:

> *****
> To join, leave or search the confocal microscopy listserv, go to:
> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
> *****
>
> What is Clover GFP? I can't find much information about it on Google.
>
> Thanks,
> Kurt
>
> On 9/14/2012 3:49 AM, George McNamara wrote:
>> *****
>> To join, leave or search the confocal microscopy listserv, go to:
>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> *****
>>
>> Hi Simon,
>>
>> Your cells might not need the 100x excess of riboflavin present in
>> "standard" DMEM, your background could be reduced. The Essen tech
>> note I mentioned lists:
>> DMEM 0.4 mg/L riboflavin ... 43.6 units fluorescence
>> Eagles MEM 0.1 mg/mL     ... 12.9
>> F12K            0.04               ... 5.4
>> EBM             0.004             ... 3.7
>> Riboflavin (alone) 0.4          ... 58.7 (perhaps suggesting that
>> culture media quenches riboflavin or it gets converted in part to
>> something less fluorescent?)
>> Contact Essen if you want the entire tech note.
>>
>>
>> If you absolutely require a green fluorescent protein, spend the time
>> to switch to the new Clover or "V6" from Steven Vogel (available from
>> addgene.org as VVVVVV).
>> If you do not need green, switch to tdTomato or the new mRuby2.
>>
>>
>>
>> Choose Destination
>>
>>    * File
>>    * Clipboard
>>    * Collections
>>    * E-mail
>>    * Order
>>    * My Bibliography
>>    * Citation manager
>>
>>    * Format
>>
>> Create File
>>
>>    * Search: clover mruby2
>>    * Format MeSH and Other Data
>>    * E-mail
>>    * Subject
>>    * Additional text
>>
>> E-mail
>> "SPAM" filtering software notice
>> </corehtml/query/MyNCBI/exquery/spam_note.html>
>> Add to Clipboard
>> Add to Collections
>> Order articles
>> Add to My Bibliography
>>
>> Generate a file for use with external citation management software.
>>
>> Create File
>> Nat Methods. <#> 2012 Sep 9. doi: 10.1038/nmeth.2171. [Epub ahead of
>> print]
>>
>>
>>  Improving FRET dynamic range with bright green and red fluorescent
>>  proteins.
>>
>> Lam AJ
>> </pubmed?term=Lam%20AJ%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>, St-Pierre
>> F
>> </pubmed?term=St-Pierre%20F%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
>> Gong Y
>> </pubmed?term=Gong%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>, Marshall
>> JD
>> </pubmed?term=Marshall%20JD%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
>> Cranfill PJ
>> </pubmed?term=Cranfill%20PJ%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
>> Baird MA
>> </pubmed?term=Baird%20MA%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
>> McKeown MR
>> </pubmed?term=McKeown%20MR%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
>> Wiedenmann J
>> </pubmed?term=Wiedenmann%20J%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
>> Davidson MW
>> </pubmed?term=Davidson%20MW%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
>> Schnitzer MJ
>> </pubmed?term=Schnitzer%20MJ%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
>> Tsien RY
>> </pubmed?term=Tsien%20RY%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>,
>> Lin MZ
>> </pubmed?term=Lin%20MZ%5BAuthor%5D&cauthor=true&cauthor_uid=22961245>.
>>
>>
>>      Source
>>
>> 1] Department of Bioengineering, Stanford University, Stanford,
>> California, USA. [2] Department of Pediatrics, Stanford University,
>> Stanford, California, USA.
>>
>>
>>      Abstract
>>
>> A variety of genetically encoded reporters use changes in
>> fluorescence resonance energy transfer (FRET) to report on
>> biochemical processes in living cells. The standard genetically
>> encoded FRET pair consists of CFPs and YFPs, but many CFP-YFP
>> reporters suffer from low FRET dynamic range, phototoxicity from the
>> CFP excitation light and complex photokinetic events such as
>> reversible photobleaching and photoconversion. We engineered two
>> fluorescent proteins,* Clover and mRuby2*, which are the brightest
>> green and red fluorescent proteins to date and have the highest
>> Förster radius of any ratiometric FRET pair yet described.
>> Replacement of CFP and YFP with these two proteins in reporters of
>> kinase activity, small GTPase activity and transmembrane voltage
>> significantly improves photostability, FRET dynamic range and
>> emission ratio changes. These improvements enhance detection of
>> transient biochemical events such as neuronal action-potential firing
>> and RhoA activation in growth cones.
>>
>> PMID:
>>    22961245
>>
>>
>> PLoS One. <#> 2012;7(5):e38209. Epub 2012 May 30.
>>
>>
>>  Fluorescence polarization and fluctuation analysis monitors subunit
>>  proximity, stoichiometry, and protein complex hydrodynamics.
>>
>> Nguyen TA
>> </pubmed?term=Nguyen%20TA%5BAuthor%5D&cauthor=true&cauthor_uid=22666486>,
>> Sarkar P
>> </pubmed?term=Sarkar%20P%5BAuthor%5D&cauthor=true&cauthor_uid=22666486>,
>> Veetil JV
>> </pubmed?term=Veetil%20JV%5BAuthor%5D&cauthor=true&cauthor_uid=22666486>,
>> Koushik SV
>> </pubmed?term=Koushik%20SV%5BAuthor%5D&cauthor=true&cauthor_uid=22666486>,
>> Vogel SS
>> </pubmed?term=Vogel%20SS%5BAuthor%5D&cauthor=true&cauthor_uid=22666486>.
>>
>>
>>      Source
>>
>> Section on Cellular Biophotonics, Laboratory of Molecular Physiology,
>> National Institute on Alcohol Abuse and Alcoholism, National
>> Institutes of Health, Rockville, Maryland, United States of America.
>>
>>
>>      Abstract
>>
>> Förster resonance energy transfer (FRET) microscopy is frequently
>> used to study protein interactions and conformational changes in
>> living cells. The utility of FRET is limited by false positive and
>> negative signals. To overcome these limitations we have developed
>> Fluorescence Polarization and Fluctuation Analysis (FPFA), a hybrid
>> single-molecule based method combining time-resolved fluorescence
>> anisotropy (homo-FRET) and fluorescence correlation spectroscopy.
>> Using FPFA, homo-FRET (a 1-10 nm proximity gauge), brightness (a
>> measure of the number of fluorescent subunits in a complex), and
>> correlation time (an attribute sensitive to the mass and shape of a
>> protein complex) can be simultaneously measured. These measurements
>> together rigorously constrain the interpretation of FRET signals.
>> Venus based control-constructs were used to validate FPFA. The
>> utility of FPFA was demonstrated by measuring in living cells the
>> number of subunits in the ?-isoform of Venus-tagged
>> calcium-calmodulin dependent protein kinase-II (CaMKII?) holoenzyme.
>> Brightness analysis revealed that the holoenzyme has, on average,
>> 11.9 ± 1.2 subunit, but values ranged from 10-14 in individual cells.
>> Homo-FRET analysis simultaneously detected that catalytic domains
>> were arranged as dimers in the dodecameric holoenzyme, and this
>> paired organization was confirmed by quantitative hetero-FRET
>> analysis. In freshly prepared cell homogenates FPFA detected only
>> 10.2 ± 1.3 subunits in the holoenzyme with values ranging from 9-12.
>> Despite the reduction in subunit number, catalytic domains were still
>> arranged as pairs in homogenates. Thus, FPFA suggests that while the
>> absolute number of subunits in an auto-inhibited holoenzyme might
>> vary from cell to cell, the organization of catalytic domains into
>> pairs is preserved.
>>
>> PMID:
>>    22666486
>>
>>
>> I am a bit disappointed Vogel's group did not go for V8 (a well known
>> drink) or V12 - the latter either as a polypeptide or with inducible
>> dimerization domain. V12 since the goal of this paper is to quantify
>> the number of subunits in CaMKIIalpha, which turns out to be 12 (+/-
>> a few) as described in
>> http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3364239/figure/pone-0038209-g004/ 
>>
>>
>> On 9/14/2012 4:32 AM, simon walker wrote:
>>> *****
>>> To join, leave or search the confocal microscopy listserv, go to:
>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>> *****
>>>
>>> Thanks for the various responses.  Yes, I'd seen the Bogdanov paper
>>> and the Evrogen medium and thought that might be worth a try.  The
>>> problem we have is that for our assay the culture medium is
>>> absolutely critical (it's not just a case of keeping cells alive),
>>> so we can't use a minimal HEPES-based buffer.  I am interested to
>>> know what is in the 'BackDrop' solution.  We can't use it unless
>>> we're fairly confident it's not going to affect our assay.
>>> Simon
>>>
>>>
>>> -----Original Message-----
>>> From: Confocal Microscopy List
>>> [mailto:[hidden email]] On Behalf Of George McNamara
>>> Sent: 14 September 2012 01:57
>>> To: [hidden email]
>>> Subject: Re: Background fluorescence problem
>>>
>>> *****
>>> To join, leave or search the confocal microscopy listserv, go to:
>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>> *****
>>>
>>> Hi Simon,
>>>
>>> likely riboflavin and possibly other flavins. See
>>> http://www.evrogen.com/products/medium_DMEM_gfp/medium_DMEM_gfp.shtml
>>> and the Bogdanov et al paper referenced  at the bottom of the page;
>>>
>>>      * Bogdanov AM, Bogdanova EA, Chudakov DM, Gorodnicheva TV,
>>> Lukyanov
>>>        S, Lukyanov KA. Cell culture medium affects GFP
>>> photostability: a
>>>        solution. Nat Methods. 2009; 6 (12):859-60. / pmid: 19935837
>>> <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=19935837&dopt=Abstract>
>>>
>>>
>>>
>>> Their solution: incubate cells in miedia without (or with low, if
>>> needed) riboflavin for a day.
>>>
>>> As a bonus, riboflavin quenches (FRET?) and/or transiently
>>> photoconverts GFP to red fluorescence (might be mostly dark states):
>>>
>>> Condensed mitotic chromosome structure at nanometer resolution using
>>> PALM and EGFP- histones.</pubmed/20856676>* Matsuda* A, Shao L,
>>> Boulanger J, Kervrann C, Carlton PM, Kner P, Agard D, *Sedat* JW.
>>> PLoS One. 2010 Sep 15;5(9):e12768. PMID: 20856676
>>>
>>>
>>> If you contact Essen Biosciences, they will (hopefully) give you a
>>> copy of their application note on the concentrations of riboflavin
>>> in many culture media and correlation with fluorescence of those
>>> media. Speaking of Essen - they finally introduced a dual green+red
>>> fluorescence Incucyte.
>>>
>>> Enjoy,
>>>
>>> George
>>>
>>>
>>>
>>> On 9/13/2012 11:04 AM, Simon Walker wrote:
>>>> *****
>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>> *****
>>>>
>>>> Dear List,
>>>> We are imaging very weakly fluorescent live cells (expressing GFP) on
>>>> a wide- field system and having issues with a source of background
>>>> fluorescence.
>>>> When we look at our cells under epi-illumination we see a rapid drop
>>>> in a weak background signal (not where the cells are) that fully
>>>> recovers over a ~10 s period after the illumination light is switched
>>>> off.  Our experiments require the use of DMEM as the imaging medium
>>>> and this is the likely cause of problem.  It appears that something in
>>>> the medium is sticking to the coverglass.  It's not phenol red as the
>>>> effect is seen with both phenol red-containing and phenol- red-free
>>>> DMEM.  Does anyone know what else it could be?  Has anyone else seen
>>>> anything similar?  We're wondering if it could be riboflavin which
>>>> is in the DMEM we're using.  Would this stick to glass?
>>>>
>>>> I've seen that Life Technologies now market a substance that allegedly
>>>> surpresses background fluorescence in DMEM:
>>>> http://products.invitrogen.com/ivgn/product/R37603
>>>> Has anyone tried this?  Does anyone know how it works?
>>>>
>>>> Thanks,
>>>> Simon
>>>>
>>>>
>>> The Babraham Institute, Babraham Research Campus, Cambridge CB22 3AT
>>> Registered Charity No. 1053902.
>>> The information transmitted in this email is directed only to the
>>> addressee. If you received this in error, please contact the sender
>>> and delete this email from your system. The contents of this e-mail
>>> are the views of the sender and do not necessarily represent the
>>> views of the Babraham Institute. Full conditions at:
>>> www.babraham.ac.uk<http://www.babraham.ac.uk/email_disclaimer.html>
>>>
>>
>>
>

[lechristophe]

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

see this article from Lin (& Tsien) in Nature Methods:
http://www.nature.com/nmeth/journal/vaop/ncurrent/full/nmeth.2171.html

Clover photostability seems to be quite worse than GFP though.

Christophe

On Fri, Sep 14, 2012 at 8:58 PM, Kurt Thorn <[hidden email]> wrote:

> *****
> To join, leave or search the confocal microscopy listserv, go to:
> http://lists.umn.edu/cgi-bin/**wa?A0=confocalmicroscopy<http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy>
> *****
>
> What is Clover GFP? I can't find much information about it on Google.
>
> Thanks,
> Kurt
>
>
> On 9/14/2012 3:49 AM, George McNamara wrote:
>
>> *****
>> To join, leave or search the confocal microscopy listserv, go to:
>> http://lists.umn.edu/cgi-bin/**wa?A0=confocalmicroscopy<http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy>
>> *****
>>
>> Hi Simon,
>>
>> Your cells might not need the 100x excess of riboflavin present in
>> "standard" DMEM, your background could be reduced. The Essen tech note I
>> mentioned lists:
>> DMEM 0.4 mg/L riboflavin ... 43.6 units fluorescence
>> Eagles MEM 0.1 mg/mL     ... 12.9
>> F12K            0.04               ... 5.4
>> EBM             0.004             ... 3.7
>> Riboflavin (alone) 0.4          ... 58.7 (perhaps suggesting that culture
>> media quenches riboflavin or it gets converted in part to something less
>> fluorescent?)
>> Contact Essen if you want the entire tech note.
>>
>>
>> If you absolutely require a green fluorescent protein, spend the time to
>> switch to the new Clover or "V6" from Steven Vogel (available from
>> addgene.org as VVVVVV).
>> If you do not need green, switch to tdTomato or the new mRuby2.
>>
>>
>>
>> Choose Destination
>>
>>    * File
>>    * Clipboard
>>    * Collections
>>    * E-mail
>>    * Order
>>    * My Bibliography
>>    * Citation manager
>>
>>    * Format
>>
>> Create File
>>
>>    * Search: clover mruby2
>>    * Format MeSH and Other Data
>>    * E-mail
>>    * Subject
>>    * Additional text
>>
>> E-mail
>> "SPAM" filtering software notice </corehtml/query/MyNCBI/**
>> exquery/spam_note.html>
>> Add to Clipboard
>> Add to Collections
>> Order articles
>> Add to My Bibliography
>>
>> Generate a file for use with external citation management software.
>>
>> Create File
>> Nat Methods. <#> 2012 Sep 9. doi: 10.1038/nmeth.2171. [Epub ahead of
>> print]
>>
>>
>>  Improving FRET dynamic range with bright green and red fluorescent
>>  proteins.
>>
>> Lam AJ </pubmed?term=Lam%20AJ%**5BAuthor%5D&cauthor=true&**cauthor_uid=22961245>,
>> St-Pierre F </pubmed?term=St-Pierre%20F%**5BAuthor%5D&cauthor=true&**cauthor_uid=22961245>,
>> Gong Y </pubmed?term=Gong%20Y%**5BAuthor%5D&cauthor=true&**cauthor_uid=22961245>,
>> Marshall JD </pubmed?term=Marshall%20JD%**5BAuthor%5D&cauthor=true&**cauthor_uid=22961245>,
>> Cranfill PJ </pubmed?term=Cranfill%20PJ%**5BAuthor%5D&cauthor=true&**cauthor_uid=22961245>,
>> Baird MA </pubmed?term=Baird%20MA%**5BAuthor%5D&cauthor=true&**cauthor_uid=22961245>,
>> McKeown MR </pubmed?term=McKeown%20MR%**5BAuthor%5D&cauthor=true&**cauthor_uid=22961245>,
>> Wiedenmann J </pubmed?term=Wiedenmann%20J%**5BAuthor%5D&cauthor=true&**cauthor_uid=22961245>,
>> Davidson MW </pubmed?term=Davidson%20MW%**5BAuthor%5D&cauthor=true&**cauthor_uid=22961245>,
>> Schnitzer MJ </pubmed?term=Schnitzer%20MJ%**5BAuthor%5D&cauthor=true&**cauthor_uid=22961245>,
>> Tsien RY </pubmed?term=Tsien%20RY%**5BAuthor%5D&cauthor=true&**cauthor_uid=22961245>,
>> Lin MZ </pubmed?term=Lin%20MZ%**5BAuthor%5D&cauthor=true&**
>> cauthor_uid=22961245>.
>>
>>
>>      Source
>>
>> 1] Department of Bioengineering, Stanford University, Stanford,
>> California, USA. [2] Department of Pediatrics, Stanford University,
>> Stanford, California, USA.
>>
>>
>>      Abstract
>>
>> A variety of genetically encoded reporters use changes in fluorescence
>> resonance energy transfer (FRET) to report on biochemical processes in
>> living cells. The standard genetically encoded FRET pair consists of CFPs
>> and YFPs, but many CFP-YFP reporters suffer from low FRET dynamic range,
>> phototoxicity from the CFP excitation light and complex photokinetic events
>> such as reversible photobleaching and photoconversion. We engineered two
>> fluorescent proteins,* Clover and mRuby2*, which are the brightest green
>> and red fluorescent proteins to date and have the highest Förster radius of
>> any ratiometric FRET pair yet described. Replacement of CFP and YFP with
>> these two proteins in reporters of kinase activity, small GTPase activity
>> and transmembrane voltage significantly improves photostability, FRET
>> dynamic range and emission ratio changes. These improvements enhance
>> detection of transient biochemical events such as neuronal action-potential
>> firing and RhoA activation in growth cones.
>>
>> PMID:
>>    22961245
>>
>>
>> PLoS One. <#> 2012;7(5):e38209. Epub 2012 May 30.
>>
>>
>>  Fluorescence polarization and fluctuation analysis monitors subunit
>>  proximity, stoichiometry, and protein complex hydrodynamics.
>>
>> Nguyen TA </pubmed?term=Nguyen%20TA%**5BAuthor%5D&cauthor=true&**cauthor_uid=22666486>,
>> Sarkar P </pubmed?term=Sarkar%20P%**5BAuthor%5D&cauthor=true&**cauthor_uid=22666486>,
>> Veetil JV </pubmed?term=Veetil%20JV%**5BAuthor%5D&cauthor=true&**cauthor_uid=22666486>,
>> Koushik SV </pubmed?term=Koushik%20SV%**5BAuthor%5D&cauthor=true&**cauthor_uid=22666486>,
>> Vogel SS </pubmed?term=Vogel%20SS%**5BAuthor%5D&cauthor=true&**
>> cauthor_uid=22666486>.
>>
>>
>>      Source
>>
>> Section on Cellular Biophotonics, Laboratory of Molecular Physiology,
>> National Institute on Alcohol Abuse and Alcoholism, National Institutes of
>> Health, Rockville, Maryland, United States of America.
>>
>>
>>      Abstract
>>
>> Förster resonance energy transfer (FRET) microscopy is frequently used to
>> study protein interactions and conformational changes in living cells. The
>> utility of FRET is limited by false positive and negative signals. To
>> overcome these limitations we have developed Fluorescence Polarization and
>> Fluctuation Analysis (FPFA), a hybrid single-molecule based method
>> combining time-resolved fluorescence anisotropy (homo-FRET) and
>> fluorescence correlation spectroscopy. Using FPFA, homo-FRET (a 1-10 nm
>> proximity gauge), brightness (a measure of the number of fluorescent
>> subunits in a complex), and correlation time (an attribute sensitive to the
>> mass and shape of a protein complex) can be simultaneously measured. These
>> measurements together rigorously constrain the interpretation of FRET
>> signals. Venus based control-constructs were used to validate FPFA. The
>> utility of FPFA was demonstrated by measuring in living cells the number of
>> subunits in the ?-isoform of Venus-tagged calcium-calmodulin dependent
>> protein kinase-II (CaMKII?) holoenzyme. Brightness analysis revealed that
>> the holoenzyme has, on average, 11.9 ± 1.2 subunit, but values ranged from
>> 10-14 in individual cells. Homo-FRET analysis simultaneously detected that
>> catalytic domains were arranged as dimers in the dodecameric holoenzyme,
>> and this paired organization was confirmed by quantitative hetero-FRET
>> analysis. In freshly prepared cell homogenates FPFA detected only 10.2 ±
>> 1.3 subunits in the holoenzyme with values ranging from 9-12. Despite the
>> reduction in subunit number, catalytic domains were still arranged as pairs
>> in homogenates. Thus, FPFA suggests that while the absolute number of
>> subunits in an auto-inhibited holoenzyme might vary from cell to cell, the
>> organization of catalytic domains into pairs is preserved.
>>
>> PMID:
>>    22666486
>>
>>
>> I am a bit disappointed Vogel's group did not go for V8 (a well known
>> drink) or V12 - the latter either as a polypeptide or with inducible
>> dimerization domain. V12 since the goal of this paper is to quantify the
>> number of subunits in CaMKIIalpha, which turns out to be 12 (+/- a few) as
>> described in http://www.ncbi.nlm.nih.gov/**pmc/articles/PMC3364239/**
>> figure/pone-0038209-g004/<http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3364239/figure/pone-0038209-g004/>
>>
>> On 9/14/2012 4:32 AM, simon walker wrote:
>>
>>> *****
>>> To join, leave or search the confocal microscopy listserv, go to:
>>> http://lists.umn.edu/cgi-bin/**wa?A0=confocalmicroscopy<http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy>
>>> *****
>>>
>>> Thanks for the various responses.  Yes, I'd seen the Bogdanov paper and
>>> the Evrogen medium and thought that might be worth a try.  The problem we
>>> have is that for our assay the culture medium is absolutely critical (it's
>>> not just a case of keeping cells alive), so we can't use a minimal
>>> HEPES-based buffer.  I am interested to know what is in the 'BackDrop'
>>> solution.  We can't use it unless we're fairly confident it's not going to
>>> affect our assay.
>>> Simon
>>>
>>>
>>> -----Original Message-----
>>> From: Confocal Microscopy List [mailto:CONFOCALMICROSCOPY@**
>>> LISTS.UMN.EDU <[hidden email]>] On Behalf Of George
>>> McNamara
>>> Sent: 14 September 2012 01:57
>>> To: [hidden email].**EDU<[hidden email]>
>>> Subject: Re: Background fluorescence problem
>>>
>>> *****
>>> To join, leave or search the confocal microscopy listserv, go to:
>>> http://lists.umn.edu/cgi-bin/**wa?A0=confocalmicroscopy<http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy>
>>> *****
>>>
>>> Hi Simon,
>>>
>>> likely riboflavin and possibly other flavins. See
>>> http://www.evrogen.com/**products/medium_DMEM_gfp/**
>>> medium_DMEM_gfp.shtml<http://www.evrogen.com/products/medium_DMEM_gfp/medium_DMEM_gfp.shtml>
>>> and the Bogdanov et al paper referenced  at the bottom of the page;
>>>
>>>      * Bogdanov AM, Bogdanova EA, Chudakov DM, Gorodnicheva TV, Lukyanov
>>>        S, Lukyanov KA. Cell culture medium affects GFP photostability: a
>>>        solution. Nat Methods. 2009; 6 (12):859-60. / pmid: 19935837
>>> <http://www.ncbi.nlm.nih.gov/**entrez/query.fcgi?cmd=**
>>> Retrieve&db=PubMed&list_uids=**19935837&dopt=Abstract<http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=19935837&dopt=Abstract>
>>> >
>>>
>>>
>>> Their solution: incubate cells in miedia without (or with low, if
>>> needed) riboflavin for a day.
>>>
>>> As a bonus, riboflavin quenches (FRET?) and/or transiently photoconverts
>>> GFP to red fluorescence (might be mostly dark states):
>>>
>>> Condensed mitotic chromosome structure at nanometer resolution using
>>> PALM and EGFP- histones.</pubmed/20856676>* Matsuda* A, Shao L, Boulanger
>>> J, Kervrann C, Carlton PM, Kner P, Agard D, *Sedat* JW. PLoS One. 2010 Sep
>>> 15;5(9):e12768. PMID: 20856676
>>>
>>>
>>> If you contact Essen Biosciences, they will (hopefully) give you a copy
>>> of their application note on the concentrations of riboflavin in many
>>> culture media and correlation with fluorescence of those media. Speaking of
>>> Essen - they finally introduced a dual green+red fluorescence Incucyte.
>>>
>>> Enjoy,
>>>
>>> George
>>>
>>>
>>>
>>> On 9/13/2012 11:04 AM, Simon Walker wrote:
>>>
>>>> *****
>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>> http://lists.umn.edu/cgi-bin/**wa?A0=confocalmicroscopy<http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy>
>>>> *****
>>>>
>>>> Dear List,
>>>> We are imaging very weakly fluorescent live cells (expressing GFP) on
>>>> a wide- field system and having issues with a source of background
>>>> fluorescence.
>>>> When we look at our cells under epi-illumination we see a rapid drop
>>>> in a weak background signal (not where the cells are) that fully
>>>> recovers over a ~10 s period after the illumination light is switched
>>>> off.  Our experiments require the use of DMEM as the imaging medium
>>>> and this is the likely cause of problem.  It appears that something in
>>>> the medium is sticking to the coverglass.  It's not phenol red as the
>>>> effect is seen with both phenol red-containing and phenol- red-free
>>>> DMEM.  Does anyone know what else it could be?  Has anyone else seen
>>>> anything similar?  We're wondering if it could be riboflavin which is
>>>> in the DMEM we're using.  Would this stick to glass?
>>>>
>>>> I've seen that Life Technologies now market a substance that allegedly
>>>> surpresses background fluorescence in DMEM:
>>>> http://products.invitrogen.**com/ivgn/product/R37603<http://products.invitrogen.com/ivgn/product/R37603>
>>>> Has anyone tried this?  Does anyone know how it works?
>>>>
>>>> Thanks,
>>>> Simon
>>>>
>>>>
>>>>  The Babraham Institute, Babraham Research Campus, Cambridge CB22 3AT
>>> Registered Charity No. 1053902.
>>> The information transmitted in this email is directed only to the
>>> addressee. If you received this in error, please contact the sender and
>>> delete this email from your system. The contents of this e-mail are the
>>> views of the sender and do not necessarily represent the views of the
>>> Babraham Institute. Full conditions at: www.babraham.ac.uk<http://www.**
>>> babraham.ac.uk/email_**disclaimer.html<http://www.babraham.ac.uk/email_disclaimer.html>
>>> >
>>>
>>>
>>
>>

[George McNamara]

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

> Hi Roger,
>
> These are not my FP's!  I read the paper a couple of days ago and
> thought it worth mentioning to the listserv.
>
> The paper states that the plasmids will be available at addgene.org -
> presumably (ok, hopefully) in sync with the print edition official
> publication date.
>
> If you are in a hurry, you could contact the PI to try to get the
> plasmids early (i.e. offer to provide your fedex number).
>
> I did not see mRuby in addgene.org either. The original mRuby paper is
> PMID:  19194514.
>
> The mRuby2 DNA sequence is available online at NCBI Nucleotide (search
> term: http://www.ncbi.nlm.nih.gov/nuccore?term=eqFP611     )
>
> Synthetic construct red fluorescent protein Ruby2 gene, partial cds
> </nuccore/JX489389.1>
>
> 711 bp linear other-genetic
>
> Accession: JX489389.1
>     GI: 404332617
>
> atggtgtcta agggcgaaga gctgatcaag gaaaatatgc gtatgaaggt ggtcatggaa 61
> ggttcggtca acggccacca attcaaatgc acaggtgaag gagaaggcaa tccgtacatg 121
> ggaactcaaa ccatgaggat caaagtcatc gagggaggac ccctgccatt tgcctttgac 181
> attcttgcca cgtcgttcat gtatggcagc cgtactttta tcaagtaccc gaaaggcatt 241
> cctgatttct ttaaacagtc ctttcctgag ggttttactt gggaaagagt tacgagatac 301
> gaagatggtg gagtcgtcac cgtcatgcag gacaccagcc ttgaggatgg ctgtctcgtt 361
> taccacgtcc aagtcagagg ggtaaacttt ccctccaatg gtcccgtgat gcagaagaag 421
> accaagggtt gggagcctaa tacagagatg atgtatccag cagatggtgg tctgagggga 481
> tacactcata tggcactgaa agttgatggt ggtggccatc tgtcttgctc tttcgtaaca 541
> acttacaggt caaaaaagac cgtcgggaac atcaagatgc ccggtatcca tgccgttgat 601
> caccgcctgg aaaggttaga ggaaagtgac aatgaaatgt tcgtagtaca acgcgaacac 661
> gcagttgcca agttcgccgg gcttggtggt gggatggacg agctgtacaa g
>
>
> I ran the above mRuby2 DNA sequence through one of the free online
> codon optimization programs - www.jcat.de   which gave a low CAI score
> (CAI 0.27) when I asked for human optimization.
>
> jcat recommends (CAI 0.96, a typical optimized score):
>
> ATGGTGAGCAAGGGCGAGGAGCTGATCAAGGAGAACATGCGCATGAAGGT 50
> GGTGATGGAGGGCAGCGTGAACGGCCACCAGTTCAAGTGCACCGGCGAGG 100
> GCGAGGGCAACCCCTACATGGGCACCCAGACCATGCGCATCAAGGTGATC 150
> GAGGGCGGCCCCCTGCCCTTCGCCTTCGACATCCTGGCCACCAGCTTCAT 200
> GTACGGCAGCCGCACCTTCATCAAGTACCCCAAGGGCATCCCCGACTTCT 250
> TCAAGCAGAGCTTCCCCGAGGGCTTCACCTGGGAGCGCGTGACCCGCTAC 300
> GAGGACGGCGGCGTGGTGACCGTGATGCAGGACACCAGCCTGGAGGACGG 350
> CTGCCTGGTGTACCACGTGCAGGTGCGCGGCGTGAACTTCCCCAGCAACG 400
> GCCCCGTGATGCAGAAGAAGACCAAGGGCTGGGAGCCCAACACCGAGATG 450
> ATGTACCCCGCCGACGGCGGCCTGCGCGGCTACACCCACATGGCCCTGAA 500
> GGTGGACGGCGGCGGCCACCTGAGCTGCAGCTTCGTGACCACCTACCGCA 550
> GCAAGAAGACCGTGGGCAACATCAAGATGCCCGGCATCCACGCCGTGGAC 600
> CACCGCCTGGAGCGCCTGGAGGAGAGCGACAACGAGATGTTCGTGGTGCA 650
> GCGCGAGCACGCCGTGGCCAAGTTCGCCGGCCTGGGCGGCGGCATGGACG 700
> AGCTGTACAAG
>
>
> Clover sequence is:
>
> Synthetic construct *green* *fluorescent* protein Clover gene, partial
> cds </nuccore/JX489388.1>
>
> 684 bp linear other-genetic
>
> Accession: JX489388.1
> GI: 404332615
>
> their sequence:
>
> 1 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 61
> ggcgacgtaa acggccacaa gttcagcgtc cgcggcgagg gcgagggcga tgccaccaac 121
> ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 181
> ctcgtgacca ccttcggcta cggcgtggcc tgcttcagcc gctaccccga ccacatgaag 241
> cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatctct 301
> ttcaaggacg acggtaccta caagacccgc gccgaggtga agttcgaggg cgacaccctg 361
> gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 421
> aagctggagt acaacttcaa cagccacaac gtctatatca cggccgacaa gcagaagaac 481
> ggcatcaagg ctaacttcaa gatccgccac aacgttgagg acggcagcgt gcagctcgcc 541
> gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 601
> tacctgagcc atcagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 661
> ctgctggagt tcgtaaccgc cgcc
>
> JCat reported a CAI of 0.79 (1.0 being perfect), and recommended: (CAI
> 0.956):
>
> ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGCGTGGTGCCCATCCTGGT 50
> GGAGCTGGACGGCGACGTGAACGGCCACAAGTTCAGCGTGCGCGGCGAGG 100
> GCGAGGGCGACGCCACCAACGGCAAGCTGACCCTGAAGTTCATCTGCACC 150
> ACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTGGTGACCACCTTCGGCTA 200
> CGGCGTGGCCTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACT 250
> TCTTCAAGAGCGCCATGCCCGAGGGCTACGTGCAGGAGCGCACCATCAGC 300
> TTCAAGGACGACGGCACCTACAAGACCCGCGCCGAGGTGAAGTTCGAGGG 350
> CGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG 400
> ACGGCAACATCCTGGGCCACAAGCTGGAGTACAACTTCAACAGCCACAAC 450
> GTGTACATCACCGCCGACAAGCAGAAGAACGGCATCAAGGCCAACTTCAA 500
> GATCCGCCACAACGTGGAGGACGGCAGCGTGCAGCTGGCCGACCACTACC 550
> AGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCAC 600
> TACCTGAGCCACCAGAGCGCCCTGAGCAAGGACCCCAACGAGAAGCGCGA 650
> CCACATGGTGCTGCTGGAGTTCGTGACCGCCGCC
>
>
>
> at 711 bases - each, you might find it cost effective to simply order
> this (or pick your favorite optimizer ... or optimize for your
> favorite organism) sequence from some DNA synthesis company.
>
> If the company charges by the gene, you could stick in a short linker
> (see the paper, or use Steven Vogel's sequence in C5V or in between
> his V's of V6) and have 711+(say)15+711 base sequence synthesized. If
> you posted that plasmid to addgene.org, and mentioned codon optimized
> for human (and maybe stuck on a promoter or maximized Gateway
> compatibility), would probably lead to being your most popular addgene
> construct and (when you publish it) most referenced technical paper.
>
> Enjoy,
>
> George
>
>
> On 9/16/2012 12:28 PM, Roger Phillips wrote:
>> Dear George,
>> Have you looked at lifetime kinetics in the transfer from Clover to mRuby2?  I only have access to the paper copy of Nature Methods so won't read the details till next month. We are about to shift from fixed to live cell imaging and we need to choose labels for [] and [].  Are the vectors for fusion construction and for controls (Clover-mRuby2 tandem construct in sup fig 9 and unfused Clover and mRuby2 available?
>> Thanks for your work,
>> Roger Phillips
>>
>> Dr Roger Guy Phillips
>> Centre for Advanced Microscopy,
>> University of Sussex
>> School of Life Sciences
>> John Maynard Smith Building
>> Falmer, Brighton&  Hove
>> BN1 9QG
>> United Kingdom
>>  
>> phone:[phone]
>> fax: [phone]
>> email:[hidden email]
>> room:2C9 (ext 7585)/lab 4C2 (ext 2734)
>>
>>
>>
>>
>> -----Original Message-----
>> From: Confocal Microscopy List [mailto:[hidden email]] On Behalf Of George McNamara
>> Sent: 15 September 2012 01:33
>> To:[hidden email]
>> Subject: Clover and mRuby2 FPs ... Re: Background fluorescence problem
>>
>> *****
>> To join, leave or search the confocal microscopy listserv, go to:
>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> *****
>>
>> Hi Kurt,
>>
>> Clover and mruby2 are described in the Lam et al paper at Nature Methods
>>
>> http://www.nature.com/nmeth/journal/vaop/ncurrent/full/nmeth.2171.html
>>
>> A variety of genetically encoded reporters use changes in fluorescence (or Förster) resonance energy transfer (FRET) to report on biochemical processes in living cells. The standard genetically encoded FRET pair consists of CFPs and YFPs, but many CFP-YFP reporters suffer from low FRET dynamic range, phototoxicity from the CFP excitation light and complex photokinetic events such as reversible photobleaching and photoconversion. We engineered two fluorescent proteins, Clover and mRuby2, which are the brightest green and red fluorescent proteins to date and have the highest Förster radius of any ratiometric FRET pair yet described. Replacement of CFP and YFP with these two proteins in reporters of kinase activity, small GTPase activity and transmembrane voltage significantly improves photostability, FRET dynamic range and emission ratio changes. These improvements enhance detection of transient biochemical events such as neuronal action-potential firing and RhoA act
>> ivation in growth cones.
>>
>>
>>
>> On 9/14/2012 2:58 PM, Kurt Thorn wrote:
>>    
>>> *****
>>> To join, leave or search the confocal microscopy listserv, go to:
>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>> *****
>>>
>>> What is Clover GFP? I can't find much information about it on Google.
>>>
>>> Thanks,
>>> Kurt
>>>
>>> On 9/14/2012 3:49 AM, George McNamara wrote:
>>>      
>>>> *****
>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>> *****
>>>>
>>>> Hi Simon,
>>>>
>>>> Your cells might not need the 100x excess of riboflavin present in
>>>> "standard" DMEM, your background could be reduced. The Essen tech
>>>> note I mentioned lists:
>>>> DMEM 0.4 mg/L riboflavin ... 43.6 units fluorescence
>>>> Eagles MEM 0.1 mg/mL     ... 12.9
>>>> F12K            0.04               ... 5.4
>>>> EBM             0.004             ... 3.7
>>>> Riboflavin (alone) 0.4          ... 58.7 (perhaps suggesting that
>>>> culture media quenches riboflavin or it gets converted in part to
>>>> something less fluorescent?) Contact Essen if you want the entire
>>>> tech note.
>>>>
>>>>
>>>> If you absolutely require a green fluorescent protein, spend the time
>>>> to switch to the new Clover or "V6" from Steven Vogel (available from
>>>> addgene.org as VVVVVV).
>>>> If you do not need green, switch to tdTomato or the new mRuby2.
>>>>
>>>>
>>>>
>>>> Create File
>>>> Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. [Epub ahead of
>>>> print]
>>>>
>>>>
>>>>   Improving FRET dynamic range with bright green and red fluorescent
>>>> proteins.
>>>>
>>>> Lam AJ (et al)
>>>>
>>>>       Abstract
>>>>
>>>> A variety of genetically encoded reporters use changes in
>>>> fluorescence resonance energy transfer (FRET) to report on
>>>> biochemical processes in living cells. The standard genetically
>>>> encoded FRET pair consists of CFPs and YFPs, but many CFP-YFP
>>>> reporters suffer from low FRET dynamic range, phototoxicity from the
>>>> CFP excitation light and complex photokinetic events such as
>>>> reversible photobleaching and photoconversion. We engineered two
>>>> fluorescent proteins,* Clover and mRuby2*, which are the brightest
>>>> green and red fluorescent proteins to date and have the highest
>>>> Förster radius of any ratiometric FRET pair yet described.
>>>> Replacement of CFP and YFP with these two proteins in reporters of
>>>> kinase activity, small GTPase activity and transmembrane voltage
>>>> significantly improves photostability, FRET dynamic range and
>>>> emission ratio changes. These improvements enhance detection of
>>>> transient biochemical events such as neuronal action-potential firing
>>>> and RhoA activation in growth cones.
>>>>
>>>> PMID:
>>>>     22961245
>>>>
>>>>
>>>> PLoS One.<#>  2012;7(5):e38209. Epub 2012 May 30.
>>>>
>>>>
>>>>   Fluorescence polarization and fluctuation analysis monitors subunit
>>>> proximity, stoichiometry, and protein complex hydrodynamics.
>>>>
>>>> Nguyen TA ...  Vogel SS
>>>>
>>>>       Abstract
>>>>
>>>> Förster resonance energy transfer (FRET) microscopy is frequently
>>>> used to study protein interactions and conformational changes in
>>>> living cells. The utility of FRET is limited by false positive and
>>>> negative signals. To overcome these limitations we have developed
>>>> Fluorescence Polarization and Fluctuation Analysis (FPFA), a hybrid
>>>> single-molecule based method combining time-resolved fluorescence
>>>> anisotropy (homo-FRET) and fluorescence correlation spectroscopy.
>>>> Using FPFA, homo-FRET (a 1-10 nm proximity gauge), brightness (a
>>>> measure of the number of fluorescent subunits in a complex), and
>>>> correlation time (an attribute sensitive to the mass and shape of a
>>>> protein complex) can be simultaneously measured. These measurements
>>>> together rigorously constrain the interpretation of FRET signals.
>>>> Venus based control-constructs were used to validate FPFA. The
>>>> utility of FPFA was demonstrated by measuring in living cells the
>>>> number of subunits in the ?-isoform of Venus-tagged
>>>> calcium-calmodulin dependent protein kinase-II (CaMKII?) holoenzyme.
>>>> Brightness analysis revealed that the holoenzyme has, on average,
>>>> 11.9 ± 1.2 subunit, but values ranged from 10-14 in individual cells.
>>>> Homo-FRET analysis simultaneously detected that catalytic domains
>>>> were arranged as dimers in the dodecameric holoenzyme, and this
>>>> paired organization was confirmed by quantitative hetero-FRET
>>>> analysis. In freshly prepared cell homogenates FPFA detected only
>>>> 10.2 ± 1.3 subunits in the holoenzyme with values ranging from 9-12.
>>>> Despite the reduction in subunit number, catalytic domains were still
>>>> arranged as pairs in homogenates. Thus, FPFA suggests that while the
>>>> absolute number of subunits in an auto-inhibited holoenzyme might
>>>> vary from cell to cell, the organization of catalytic domains into
>>>> pairs is preserved.
>>>>
>>>> PMID:
>>>>     22666486
>>>>
>>>>
>>>> I am a bit disappointed Vogel's group did not go for V8 (a well known
>>>> drink) or V12 - the latter either as a polypeptide or with inducible
>>>> dimerization domain. V12 since the goal of this paper is to quantify
>>>> the number of subunits in CaMKIIalpha, which turns out to be 12 (+/-
>>>> a few) as described in
>>>> http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3364239/figure/pone-00382
>>>> 09-g004/
>>>>
>>>>
>>>> On 9/14/2012 4:32 AM, simon walker wrote:
>>>>        
>>>>> *****
>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>> *****
>>>>>
>>>>> Thanks for the various responses.  Yes, I'd seen the Bogdanov paper
>>>>> and the Evrogen medium and thought that might be worth a try.  The
>>>>> problem we have is that for our assay the culture medium is
>>>>> absolutely critical (it's not just a case of keeping cells alive),
>>>>> so we can't use a minimal HEPES-based buffer.  I am interested to
>>>>> know what is in the 'BackDrop' solution.  We can't use it unless
>>>>> we're fairly confident it's not going to affect our assay.
>>>>> Simon
>>>>>
>>>>>
>>>>> -----Original Message-----
>>>>> From: Confocal Microscopy List
>>>>> [mailto:[hidden email]] On Behalf Of George
>>>>> McNamara
>>>>> Sent: 14 September 2012 01:57
>>>>> To:[hidden email]
>>>>> Subject: Re: Background fluorescence problem
>>>>>
>>>>> *****
>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>> *****
>>>>>
>>>>> Hi Simon,
>>>>>
>>>>> likely riboflavin and possibly other flavins. See
>>>>> http://www.evrogen.com/products/medium_DMEM_gfp/medium_DMEM_gfp.shtm
>>>>> l and the Bogdanov et al paper referenced  at the bottom of the
>>>>> page;
>>>>>
>>>>>       * Bogdanov AM, Bogdanova EA, Chudakov DM, Gorodnicheva TV,
>>>>> Lukyanov
>>>>>         S, Lukyanov KA. Cell culture medium affects GFP
>>>>> photostability: a
>>>>>         solution. Nat Methods. 2009; 6 (12):859-60. / pmid: 19935837
>>>>> <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMe
>>>>> d&list_uids=19935837&dopt=Abstract>
>>>>>
>>>>>
>>>>>
>>>>> Their solution: incubate cells in miedia without (or with low, if
>>>>> needed) riboflavin for a day.
>>>>>
>>>>> As a bonus, riboflavin quenches (FRET?) and/or transiently
>>>>> photoconverts GFP to red fluorescence (might be mostly dark states):
>>>>>
>>>>> Condensed mitotic chromosome structure at nanometer resolution using
>>>>> PALM and EGFP- histones.</pubmed/20856676>* Matsuda* A, Shao L,
>>>>> Boulanger J, Kervrann C, Carlton PM, Kner P, Agard D, *Sedat* JW.
>>>>> PLoS One. 2010 Sep 15;5(9):e12768. PMID: 20856676
>>>>>
>>>>>
>>>>> If you contact Essen Biosciences, they will (hopefully) give you a
>>>>> copy of their application note on the concentrations of riboflavin
>>>>> in many culture media and correlation with fluorescence of those
>>>>> media. Speaking of Essen - they finally introduced a dual green+red
>>>>> fluorescence Incucyte.
>>>>>
>>>>> Enjoy,
>>>>>
>>>>> George
>>>>>
>>>>>
>>>>>
>>>>> On 9/13/2012 11:04 AM, Simon Walker wrote:
>>>>>          
>>>>>> *****
>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>> *****
>>>>>>
>>>>>> Dear List,
>>>>>> We are imaging very weakly fluorescent live cells (expressing GFP)
>>>>>> on a wide- field system and having issues with a source of
>>>>>> background fluorescence.
>>>>>> When we look at our cells under epi-illumination we see a rapid
>>>>>> drop in a weak background signal (not where the cells are) that
>>>>>> fully recovers over a ~10 s period after the illumination light is
>>>>>> switched off.  Our experiments require the use of DMEM as the
>>>>>> imaging medium and this is the likely cause of problem.  It appears
>>>>>> that something in the medium is sticking to the coverglass.  It's
>>>>>> not phenol red as the effect is seen with both phenol
>>>>>> red-containing and phenol- red-free DMEM.  Does anyone know what
>>>>>> else it could be?  Has anyone else seen anything similar?  We're
>>>>>> wondering if it could be riboflavin which is in the DMEM we're using.  Would this stick to glass?
>>>>>>
>>>>>> I've seen that Life Technologies now market a substance that
>>>>>> allegedly surpresses background fluorescence in DMEM:
>>>>>> http://products.invitrogen.com/ivgn/product/R37603
>>>>>> Has anyone tried this?  Does anyone know how it works?
>>>>>>
>>>>>> Thanks,
>>>>>> Simon
>>>>>>
>>>>>>
>>>>>>            
>>>>> The Babraham Institute, Babraham Research Campus, Cambridge CB22 3AT
>>>>> Registered Charity No. 1053902.
>>>>> The information transmitted in this email is directed only to the
>>>>> addressee. If you received this in error, please contact the sender
>>>>> and delete this email from your system. The contents of this e-mail
>>>>> are the views of the sender and do not necessarily represent the
>>>>> views of the Babraham Institute. Full conditions at:
>>>>> www.babraham.ac.uk<http://www.babraham.ac.uk/email_disclaimer.html>

[Arvydas Matiukas]

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

Dear list,
 
please advise where to find simple and short (<30-40 pages)
user training manual for Nikon confocal. Our system is C2 but
I guess C1 or A1 would be good as long as it runs on NIS Elements
v4.0 software.
 
There were several good manuals available on the web for the good
old LSM510 machine. However, I was not able to find anything similar
for Nikon C2 confocal. I like the structure of LSM510 manual so much
that I even consider modifying myself all the LSM510 workflows to be
 relevant to the C2 confocal.
 
Any advise and/or suggestion are very welcome.
 
Thanks,
Arvydas
 
 
Arvydas Matiukas, Ph.D.
Director of Confocal&Two-Photon Core
Department of Pharmacology
SUNY Upstate Medical University
766 Irving Ave., WH 3167
Syracuse, NY 13210
tel.: [phone]
fax: [phone]
email: [hidden email]

[Christian-103]

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****


Arvydas,

I believe you hit the problem on the head.  There is no training manual for the Elements software specifically for the confocals.  I have been able to find a few basic Elements manuals by searching for .pdf online, but I believe those are being hosted by non-Nikon people.

Good luck, if you do find anything, please share the information.

Christian


--- On Thu, 9/20/12, Arvydas Matiukas <[hidden email]> wrote:

From: Arvydas Matiukas <[hidden email]>
Subject: Training manual for Nikon confocal
To: [hidden email]
Date: Thursday, September 20, 2012, 10:40 AM

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

Dear list,
 
please advise where to find simple and short (<30-40 pages)
user training manual for Nikon confocal. Our system is C2 but
I guess C1 or A1 would be good as long as it runs on NIS Elements
v4.0 software.
 
There were several good manuals available on the web for the good
old LSM510 machine. However, I was not able to find anything similar
for Nikon C2 confocal. I like the structure of LSM510 manual so much
that I even consider modifying myself all the LSM510 workflows to be
 relevant to the C2 confocal.
 
Any advise and/or suggestion are very welcome.
 
Thanks,
Arvydas
 
 
Arvydas Matiukas, Ph.D.
Director of Confocal&Two-Photon Core
Department of Pharmacology
SUNY Upstate Medical University
766 Irving Ave., WH 3167
Syracuse, NY 13210
tel.: [phone]
fax: [phone]
email: [hidden email]

[Arvydas Matiukas]

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

Hi Christian,
 
I think that some people (sales related?) misinterpreted the issue
that I brought up. Training (and training manual) for confocal is like the safe driving
course provided to beginner (student) driver by driving schools.
Car manufacturers do not provide this service or training materials. On the other hand,
I by no ways mean that this lowers the value/quality of C2 confocal or NIS software .
Actually in many respects it is better than other older confocals in our Core (no commercial interest!).
 
Thanks to the combined effort of Nikon representatives and Core Managers I was offered
3 simple manuals for training/beginner users (two for C2, and one for A1 confocal).
They are OK but still to my opinion lack introduction to confocal, and review of basic
imaging applications (which I am planing to add in the future).
 
If somebody is interested in the above training manuals please contact
your local Nikon representative or me directly.
 
Thanks for everybody who kindly helped with the manuals,
Arvydas

>>> Christian <[hidden email]> 9/21/2012 11:06 AM >>>
*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy 
*****


Arvydas,

I believe you hit the problem on the head.  There is no training manual for the Elements software specifically for the confocals.  I have been able to find a few basic Elements manuals by searching for .pdf online, but I believe those are being hosted by non-Nikon people.

Good luck, if you do find anything, please share the information.

Christian


--- On Thu, 9/20/12, Arvydas Matiukas <[hidden email]> wrote:

From: Arvydas Matiukas <[hidden email]>
Subject: Training manual for Nikon confocal
To: [hidden email]
Date: Thursday, September 20, 2012, 10:40 AM

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy 
*****

Dear list,

please advise where to find simple and short (<30-40 pages)
user training manual for Nikon confocal. Our system is C2 but
I guess C1 or A1 would be good as long as it runs on NIS Elements
v4.0 software.

There were several good manuals available on the web for the good
old LSM510 machine. However, I was not able to find anything similar
for Nikon C2 confocal. I like the structure of LSM510 manual so much
that I even consider modifying myself all the LSM510 workflows to be
relevant to the C2 confocal.

Any advise and/or suggestion are very welcome.

Thanks,
Arvydas


Arvydas Matiukas, Ph.D.
Director of Confocal&Two-Photon Core
Department of Pharmacology
SUNY Upstate Medical University
766 Irving Ave., WH 3167
Syracuse, NY 13210
tel.: [phone]
fax: [phone]
email: [hidden email]

[Tobias Rose]

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

Hi everybody,

Sorry to warm up this old thread and please excuse the lengthy post - but I am about to do precisely what George suggested: Synthesize mRuby2. (well: without the publish to addgene and try to snatch citations away from R. Tsien bit...). And by the way: All plasmids from that publication are available on addgene now: http://www.addgene.org/browse/article/5906/ .
Be aware that there are quite a few tags on the N-terminus of mRuby2...

The question that I am asking myself for a while now is:
Is codon optimization really worth it?

Due to lack of time and to increase turnover I am by now synthesizing most of my DNA. With the breakneck speed that fluorescent proteins and genetically encoded functional indicators are developed right now it's almost impossible to keep up without synthesis. And it’s also very convenient...

However: besides all the PR talk of synthesis companies I don't really know if codon optimization (for mouse in my case) would do more harm than good. For instance, next to all the semi-anecdotal optimization papers out there there is still this Science paper here:

Coding-Sequence Determinants of Gene Expression in Escherichia coli
Grzegorz Kudla, Andrew W. Murray, David Tollervey, and Joshua B. Plotkin
Science 10 April 2009: 324 (5924), 255-258. [DOI:10.1126/science.1170160]

At least in e. coli codon usage appears to not matter at all (see also discussion here: http://omicsomics.blogspot.de/2009/04/is-codon-optimization-bunk.html ).

Also, even though I cannot judge it, it's stated in my 'AAV cookbook': "[...It should be noted, however, that the potential for introduction of sequences that negatively affect gene expression is also a risk with this process, and it is difficult to predict which sequences will have such an effect. For example, it has been shown that the sequences coding for protein domain boundaries are more likely to be coded by “translationally slow” codons [...]"
Gray, J. T. & Zolotukhin, S. Adeno-Associated Virus. 807, 25–46 (2011).

Right now I don't even know if the run of the mill XFPs available from addgene or Tsien himself _are_ in any way codon-optimized away from the original species towards mammalian use.

Whould you say that it makes sense, for example, to further 'optimize'  very established sequences like standard XFPs (in my case for tdtomato and GCaMPx (genetically-encoded Ca2+ indicator [GFP + calmodulin + M13peptide])?  The problem with the CAI score that George posted (next to the fact that that's only one out of many ways to codon optimize) is that I'm getting entirely different CAI scores from different calculators and especially also for different mammalian species  (e.g. human vs. mouse - is codon usage really that different here?):

Example:
mRUBY2 CDS

www.jcat.de
human
before opt:
CAI 0.27

After opt:
CAI 0.95

Mouse (my target):
before opt
CAI 0.23

after opt:
CAI 0.72

Same sequence with genscript:
http://www.genscript.com/cgi-bin/tools/rare_codon_analysis

human
before opt
CAI : 0.75

Mouse
before opt
CAI : 0.75

As usual, optimisation is proprietary here… and might be biased towards ease of synthesis and not necessary towards best possible expression.

And then there is the entirely different optimization from other companies like DNA2.0...

What is your opinion: voodoo or not? Would you change 'established' sequences to increase expression - or would you just optimize when you switch species?

Thanks,T

Also: What's your bet - is mRuby2 the best red/orange protein ever -- or would you still use mCherry or (td)tomato in spite of all the cytotoxicity rumours?

> -----Original Message-----
> From: Confocal Microscopy List
> [mailto:[hidden email]] On Behalf Of George
> McNamara
> Sent: Sunday, September 16, 2012 7:21 PM
> To: [hidden email]
> Subject: Re: Clover and mRuby2 FPs ... Re: Background fluorescence
> problem
>
> *****
> To join, leave or search the confocal microscopy listserv, go to:
> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
> *****
>
>
> > Hi Roger,
> >
> > These are not my FP's!  I read the paper a couple of days ago and
> > thought it worth mentioning to the listserv.
> >
> > The paper states that the plasmids will be available at addgene.org -
> > presumably (ok, hopefully) in sync with the print edition official
> > publication date.
> >
> > If you are in a hurry, you could contact the PI to try to get the
> > plasmids early (i.e. offer to provide your fedex number).
> >
> > I did not see mRuby in addgene.org either. The original mRuby paper is
> > PMID:  19194514.
> >
> > The mRuby2 DNA sequence is available online at NCBI Nucleotide (search
> > term: http://www.ncbi.nlm.nih.gov/nuccore?term=eqFP611      )
> >
> > Synthetic construct red fluorescent protein Ruby2 gene, partial cds
> > </nuccore/JX489389.1>
> >
> > 711 bp linear other-genetic
> >
> > Accession: JX489389.1
> >     GI: 404332617
> >
> > atggtgtcta agggcgaaga gctgatcaag gaaaatatgc gtatgaaggt ggtcatggaa 61
> > ggttcggtca acggccacca attcaaatgc acaggtgaag gagaaggcaa tccgtacatg 121
> > ggaactcaaa ccatgaggat caaagtcatc gagggaggac ccctgccatt tgcctttgac 181
> > attcttgcca cgtcgttcat gtatggcagc cgtactttta tcaagtaccc gaaaggcatt 241
> > cctgatttct ttaaacagtc ctttcctgag ggttttactt gggaaagagt tacgagatac 301
> > gaagatggtg gagtcgtcac cgtcatgcag gacaccagcc ttgaggatgg ctgtctcgtt 361
> > taccacgtcc aagtcagagg ggtaaacttt ccctccaatg gtcccgtgat gcagaagaag 421
> > accaagggtt gggagcctaa tacagagatg atgtatccag cagatggtgg tctgagggga 481
> > tacactcata tggcactgaa agttgatggt ggtggccatc tgtcttgctc tttcgtaaca 541
> > acttacaggt caaaaaagac cgtcgggaac atcaagatgc ccggtatcca tgccgttgat 601
> > caccgcctgg aaaggttaga ggaaagtgac aatgaaatgt tcgtagtaca acgcgaacac 661
> > gcagttgcca agttcgccgg gcttggtggt gggatggacg agctgtacaa g
> >
> >
> > I ran the above mRuby2 DNA sequence through one of the free online
> > codon optimization programs - www.jcat.de   which gave a low CAI score
> > (CAI 0.27) when I asked for human optimization.
> >
> > jcat recommends (CAI 0.96, a typical optimized score):
> >
> > ATGGTGAGCAAGGGCGAGGAGCTGATCAAGGAGAACATGCGCATGAAGGT 50
> > GGTGATGGAGGGCAGCGTGAACGGCCACCAGTTCAAGTGCACCGGCGAGG 100
> > GCGAGGGCAACCCCTACATGGGCACCCAGACCATGCGCATCAAGGTGATC 150
> > GAGGGCGGCCCCCTGCCCTTCGCCTTCGACATCCTGGCCACCAGCTTCAT 200
> > GTACGGCAGCCGCACCTTCATCAAGTACCCCAAGGGCATCCCCGACTTCT 250
> > TCAAGCAGAGCTTCCCCGAGGGCTTCACCTGGGAGCGCGTGACCCGCTAC 300
> > GAGGACGGCGGCGTGGTGACCGTGATGCAGGACACCAGCCTGGAGGACGG 350
> > CTGCCTGGTGTACCACGTGCAGGTGCGCGGCGTGAACTTCCCCAGCAACG 400
> > GCCCCGTGATGCAGAAGAAGACCAAGGGCTGGGAGCCCAACACCGAGATG 450
> > ATGTACCCCGCCGACGGCGGCCTGCGCGGCTACACCCACATGGCCCTGAA 500
> > GGTGGACGGCGGCGGCCACCTGAGCTGCAGCTTCGTGACCACCTACCGCA 550
> > GCAAGAAGACCGTGGGCAACATCAAGATGCCCGGCATCCACGCCGTGGAC 600
> > CACCGCCTGGAGCGCCTGGAGGAGAGCGACAACGAGATGTTCGTGGTGCA 650
> > GCGCGAGCACGCCGTGGCCAAGTTCGCCGGCCTGGGCGGCGGCATGGACG 700
> AGCTGTACAAG
> >
> >
> > Clover sequence is:
> >
> > Synthetic construct *green* *fluorescent* protein Clover gene, partial
> > cds </nuccore/JX489388.1>
> >
> > 684 bp linear other-genetic
> >
> > Accession: JX489388.1
> > GI: 404332615
> >
> > their sequence:
> >
> > 1 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 61
> > ggcgacgtaa acggccacaa gttcagcgtc cgcggcgagg gcgagggcga tgccaccaac 121
> > ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 181
> > ctcgtgacca ccttcggcta cggcgtggcc tgcttcagcc gctaccccga ccacatgaag 241
> > cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatctct 301
> > ttcaaggacg acggtaccta caagacccgc gccgaggtga agttcgaggg cgacaccctg 361
> > gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 421
> > aagctggagt acaacttcaa cagccacaac gtctatatca cggccgacaa gcagaagaac 481
> > ggcatcaagg ctaacttcaa gatccgccac aacgttgagg acggcagcgt gcagctcgcc 541
> > gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 601
> > tacctgagcc atcagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 661
> > ctgctggagt tcgtaaccgc cgcc
> >
> > JCat reported a CAI of 0.79 (1.0 being perfect), and recommended: (CAI
> > 0.956):
> >
> > ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGCGTGGTGCCCATCCTGGT 50
> > GGAGCTGGACGGCGACGTGAACGGCCACAAGTTCAGCGTGCGCGGCGAGG 100
> > GCGAGGGCGACGCCACCAACGGCAAGCTGACCCTGAAGTTCATCTGCACC 150
> > ACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTGGTGACCACCTTCGGCTA 200
> > CGGCGTGGCCTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACT 250
> > TCTTCAAGAGCGCCATGCCCGAGGGCTACGTGCAGGAGCGCACCATCAGC 300
> > TTCAAGGACGACGGCACCTACAAGACCCGCGCCGAGGTGAAGTTCGAGGG 350
> > CGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG 400
> > ACGGCAACATCCTGGGCCACAAGCTGGAGTACAACTTCAACAGCCACAAC 450
> > GTGTACATCACCGCCGACAAGCAGAAGAACGGCATCAAGGCCAACTTCAA 500
> > GATCCGCCACAACGTGGAGGACGGCAGCGTGCAGCTGGCCGACCACTACC 550
> > AGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCAC 600
> > TACCTGAGCCACCAGAGCGCCCTGAGCAAGGACCCCAACGAGAAGCGCGA 650
> > CCACATGGTGCTGCTGGAGTTCGTGACCGCCGCC
> >
> >
> >
> > at 711 bases - each, you might find it cost effective to simply order
> > this (or pick your favorite optimizer ... or optimize for your
> > favorite organism) sequence from some DNA synthesis company.
> >
> > If the company charges by the gene, you could stick in a short linker
> > (see the paper, or use Steven Vogel's sequence in C5V or in between
> > his V's of V6) and have 711+(say)15+711 base sequence synthesized. If
> > you posted that plasmid to addgene.org, and mentioned codon optimized
> > for human (and maybe stuck on a promoter or maximized Gateway
> > compatibility), would probably lead to being your most popular addgene
> > construct and (when you publish it) most referenced technical paper.
> >
> > Enjoy,
> >
> > George
> >
> >
> > On 9/16/2012 12:28 PM, Roger Phillips wrote:
> >> Dear George,
> >> Have you looked at lifetime kinetics in the transfer from Clover to
> mRuby2?  I only have access to the paper copy of Nature Methods so won't
> read the details till next month. We are about to shift from fixed to live cell
> imaging and we need to choose labels for [] and [].  Are the vectors for
> fusion construction and for controls (Clover-mRuby2 tandem construct in
> sup fig 9 and unfused Clover and mRuby2 available?
> >> Thanks for your work,
> >> Roger Phillips
> >>
> >> Dr Roger Guy Phillips
> >> Centre for Advanced Microscopy,
> >> University of Sussex
> >> School of Life Sciences
> >> John Maynard Smith Building
> >> Falmer, Brighton&  Hove
> >> BN1 9QG
> >> United Kingdom
> >>
> >> phone:[phone]
> >> fax: [phone]
> >> email:[hidden email]
> >> room:2C9 (ext 7585)/lab 4C2 (ext 2734)
> >>
> >>
> >>
> >>
> >> -----Original Message-----
> >> From: Confocal Microscopy List
> >> [mailto:[hidden email]] On Behalf Of George
> >> McNamara
> >> Sent: 15 September 2012 01:33
> >> To:[hidden email]
> >> Subject: Clover and mRuby2 FPs ... Re: Background fluorescence
> >> problem
> >>
> >> *****
> >> To join, leave or search the confocal microscopy listserv, go to:
> >> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
> >> *****
> >>
> >> Hi Kurt,
> >>
> >> Clover and mruby2 are described in the Lam et al paper at Nature
> >> Methods
> >>
> >>
> http://www.nature.com/nmeth/journal/vaop/ncurrent/full/nmeth.2171.ht
> m
> >> l
> >>
> >> A variety of genetically encoded reporters use changes in
> >> fluorescence (or Förster) resonance energy transfer (FRET) to report on
> biochemical processes in living cells. The standard genetically encoded FRET
> pair consists of CFPs and YFPs, but many CFP-YFP reporters suffer from low
> FRET dynamic range, phototoxicity from the CFP excitation light and
> complex photokinetic events such as reversible photobleaching and
> photoconversion. We engineered two fluorescent proteins, Clover and
> mRuby2, which are the brightest green and red fluorescent proteins to date
> and have the highest Förster radius of any ratiometric FRET pair yet
> described. Replacement of CFP and YFP with these two proteins in reporters
> of kinase activity, small GTPase activity and transmembrane voltage
> significantly improves photostability, FRET dynamic range and emission
> ratio changes. These improvements enhance detection of transient
> biochemical events such as neuronal action-potential firing and RhoA act
> ivation in growth cones.
> >>
> >>
> >>
> >> On 9/14/2012 2:58 PM, Kurt Thorn wrote:
> >>
> >>> *****
> >>> To join, leave or search the confocal microscopy listserv, go to:
> >>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
> >>> *****
> >>>
> >>> What is Clover GFP? I can't find much information about it on Google.
> >>>
> >>> Thanks,
> >>> Kurt
> >>>
> >>> On 9/14/2012 3:49 AM, George McNamara wrote:
> >>>
> >>>> *****
> >>>> To join, leave or search the confocal microscopy listserv, go to:
> >>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
> >>>> *****
> >>>>
> >>>> Hi Simon,
> >>>>
> >>>> Your cells might not need the 100x excess of riboflavin present in
> >>>> "standard" DMEM, your background could be reduced. The Essen tech
> >>>> note I mentioned lists:
> >>>> DMEM 0.4 mg/L riboflavin ... 43.6 units fluorescence
> >>>> Eagles MEM 0.1 mg/mL     ... 12.9
> >>>> F12K            0.04               ... 5.4
> >>>> EBM             0.004             ... 3.7
> >>>> Riboflavin (alone) 0.4          ... 58.7 (perhaps suggesting that
> >>>> culture media quenches riboflavin or it gets converted in part to
> >>>> something less fluorescent?) Contact Essen if you want the entire
> >>>> tech note.
> >>>>
> >>>>
> >>>> If you absolutely require a green fluorescent protein, spend the
> >>>> time to switch to the new Clover or "V6" from Steven Vogel
> >>>> (available from addgene.org as VVVVVV).
> >>>> If you do not need green, switch to tdTomato or the new mRuby2.
> >>>>
> >>>>
> >>>>
> >>>> Create File
> >>>> Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. [Epub ahead of
> >>>> print]
> >>>>
> >>>>
> >>>>   Improving FRET dynamic range with bright green and red
> >>>> fluorescent proteins.
> >>>>
> >>>> Lam AJ (et al)
> >>>>
> >>>>       Abstract
> >>>>
> >>>> A variety of genetically encoded reporters use changes in
> >>>> fluorescence resonance energy transfer (FRET) to report on
> >>>> biochemical processes in living cells. The standard genetically
> >>>> encoded FRET pair consists of CFPs and YFPs, but many CFP-YFP
> >>>> reporters suffer from low FRET dynamic range, phototoxicity from
> >>>> the CFP excitation light and complex photokinetic events such as
> >>>> reversible photobleaching and photoconversion. We engineered two
> >>>> fluorescent proteins,* Clover and mRuby2*, which are the brightest
> >>>> green and red fluorescent proteins to date and have the highest
> >>>> Förster radius of any ratiometric FRET pair yet described.
> >>>> Replacement of CFP and YFP with these two proteins in reporters of
> >>>> kinase activity, small GTPase activity and transmembrane voltage
> >>>> significantly improves photostability, FRET dynamic range and
> >>>> emission ratio changes. These improvements enhance detection of
> >>>> transient biochemical events such as neuronal action-potential
> >>>> firing and RhoA activation in growth cones.
> >>>>
> >>>> PMID:
> >>>>     22961245
> >>>>
> >>>>
> >>>> PLoS One.<#>  2012;7(5):e38209. Epub 2012 May 30.
> >>>>
> >>>>
> >>>>   Fluorescence polarization and fluctuation analysis monitors
> >>>> subunit proximity, stoichiometry, and protein complex hydrodynamics.
> >>>>
> >>>> Nguyen TA ...  Vogel SS
> >>>>
> >>>>       Abstract
> >>>>
> >>>> Förster resonance energy transfer (FRET) microscopy is frequently
> >>>> used to study protein interactions and conformational changes in
> >>>> living cells. The utility of FRET is limited by false positive and
> >>>> negative signals. To overcome these limitations we have developed
> >>>> Fluorescence Polarization and Fluctuation Analysis (FPFA), a hybrid
> >>>> single-molecule based method combining time-resolved fluorescence
> >>>> anisotropy (homo-FRET) and fluorescence correlation spectroscopy.
> >>>> Using FPFA, homo-FRET (a 1-10 nm proximity gauge), brightness (a
> >>>> measure of the number of fluorescent subunits in a complex), and
> >>>> correlation time (an attribute sensitive to the mass and shape of a
> >>>> protein complex) can be simultaneously measured. These
> measurements
> >>>> together rigorously constrain the interpretation of FRET signals.
> >>>> Venus based control-constructs were used to validate FPFA. The
> >>>> utility of FPFA was demonstrated by measuring in living cells the
> >>>> number of subunits in the ?-isoform of Venus-tagged
> >>>> calcium-calmodulin dependent protein kinase-II (CaMKII?)
> holoenzyme.
> >>>> Brightness analysis revealed that the holoenzyme has, on average,
> >>>> 11.9 ± 1.2 subunit, but values ranged from 10-14 in individual cells.
> >>>> Homo-FRET analysis simultaneously detected that catalytic domains
> >>>> were arranged as dimers in the dodecameric holoenzyme, and this
> >>>> paired organization was confirmed by quantitative hetero-FRET
> >>>> analysis. In freshly prepared cell homogenates FPFA detected only
> >>>> 10.2 ± 1.3 subunits in the holoenzyme with values ranging from 9-12.
> >>>> Despite the reduction in subunit number, catalytic domains were
> >>>> still arranged as pairs in homogenates. Thus, FPFA suggests that
> >>>> while the absolute number of subunits in an auto-inhibited
> >>>> holoenzyme might vary from cell to cell, the organization of
> >>>> catalytic domains into pairs is preserved.
> >>>>
> >>>> PMID:
> >>>>     22666486
> >>>>
> >>>>
> >>>> I am a bit disappointed Vogel's group did not go for V8 (a well
> >>>> known
> >>>> drink) or V12 - the latter either as a polypeptide or with
> >>>> inducible dimerization domain. V12 since the goal of this paper is
> >>>> to quantify the number of subunits in CaMKIIalpha, which turns out
> >>>> to be 12 (+/- a few) as described in
> >>>> http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3364239/figure/pone-
> 003
> >>>> 82
> >>>> 09-g004/
> >>>>
> >>>>
> >>>> On 9/14/2012 4:32 AM, simon walker wrote:
> >>>>
> >>>>> *****
> >>>>> To join, leave or search the confocal microscopy listserv, go to:
> >>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
> >>>>> *****
> >>>>>
> >>>>> Thanks for the various responses.  Yes, I'd seen the Bogdanov
> >>>>> paper and the Evrogen medium and thought that might be worth a
> >>>>> try.  The problem we have is that for our assay the culture medium
> >>>>> is absolutely critical (it's not just a case of keeping cells
> >>>>> alive), so we can't use a minimal HEPES-based buffer.  I am
> >>>>> interested to know what is in the 'BackDrop' solution.  We can't
> >>>>> use it unless we're fairly confident it's not going to affect our assay.
> >>>>> Simon
> >>>>>
> >>>>>
> >>>>> -----Original Message-----
> >>>>> From: Confocal Microscopy List
> >>>>> [mailto:[hidden email]] On Behalf Of
> George
> >>>>> McNamara
> >>>>> Sent: 14 September 2012 01:57
> >>>>> To:[hidden email]
> >>>>> Subject: Re: Background fluorescence problem
> >>>>>
> >>>>> *****
> >>>>> To join, leave or search the confocal microscopy listserv, go to:
> >>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
> >>>>> *****
> >>>>>
> >>>>> Hi Simon,
> >>>>>
> >>>>> likely riboflavin and possibly other flavins. See
> >>>>>
> http://www.evrogen.com/products/medium_DMEM_gfp/medium_DMEM_
> gfp.sh
> >>>>> tm l and the Bogdanov et al paper referenced  at the bottom of the
> >>>>> page;
> >>>>>
> >>>>>       * Bogdanov AM, Bogdanova EA, Chudakov DM, Gorodnicheva TV,
> >>>>> Lukyanov
> >>>>>         S, Lukyanov KA. Cell culture medium affects GFP
> >>>>> photostability: a
> >>>>>         solution. Nat Methods. 2009; 6 (12):859-60. / pmid:
> >>>>> 19935837
> >>>>>
> <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Pub
> >>>>> Me d&list_uids=19935837&dopt=Abstract>
> >>>>>
> >>>>>
> >>>>>
> >>>>> Their solution: incubate cells in miedia without (or with low, if
> >>>>> needed) riboflavin for a day.
> >>>>>
> >>>>> As a bonus, riboflavin quenches (FRET?) and/or transiently
> >>>>> photoconverts GFP to red fluorescence (might be mostly dark states):
> >>>>>
> >>>>> Condensed mitotic chromosome structure at nanometer resolution
> >>>>> using PALM and EGFP- histones.</pubmed/20856676>* Matsuda* A,
> Shao
> >>>>> L, Boulanger J, Kervrann C, Carlton PM, Kner P, Agard D, *Sedat* JW.
> >>>>> PLoS One. 2010 Sep 15;5(9):e12768. PMID: 20856676
> >>>>>
> >>>>>
> >>>>> If you contact Essen Biosciences, they will (hopefully) give you a
> >>>>> copy of their application note on the concentrations of riboflavin
> >>>>> in many culture media and correlation with fluorescence of those
> >>>>> media. Speaking of Essen - they finally introduced a dual
> >>>>> green+red fluorescence Incucyte.
> >>>>>
> >>>>> Enjoy,
> >>>>>
> >>>>> George
> >>>>>
> >>>>>
> >>>>>
> >>>>> On 9/13/2012 11:04 AM, Simon Walker wrote:
> >>>>>
> >>>>>> *****
> >>>>>> To join, leave or search the confocal microscopy listserv, go to:
> >>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
> >>>>>> *****
> >>>>>>
> >>>>>> Dear List,
> >>>>>> We are imaging very weakly fluorescent live cells (expressing
> >>>>>> GFP) on a wide- field system and having issues with a source of
> >>>>>> background fluorescence.
> >>>>>> When we look at our cells under epi-illumination we see a rapid
> >>>>>> drop in a weak background signal (not where the cells are) that
> >>>>>> fully recovers over a ~10 s period after the illumination light
> >>>>>> is switched off.  Our experiments require the use of DMEM as the
> >>>>>> imaging medium and this is the likely cause of problem.  It
> >>>>>> appears that something in the medium is sticking to the
> >>>>>> coverglass.  It's not phenol red as the effect is seen with both
> >>>>>> phenol red-containing and phenol- red-free DMEM.  Does anyone
> >>>>>> know what else it could be?  Has anyone else seen anything
> >>>>>> similar?  We're wondering if it could be riboflavin which is in the
> DMEM we're using.  Would this stick to glass?
> >>>>>>
> >>>>>> I've seen that Life Technologies now market a substance that
> >>>>>> allegedly surpresses background fluorescence in DMEM:
> >>>>>> http://products.invitrogen.com/ivgn/product/R37603
> >>>>>> Has anyone tried this?  Does anyone know how it works?
> >>>>>>
> >>>>>> Thanks,
> >>>>>> Simon
> >>>>>>
> >>>>>>
> >>>>>>
> >>>>> The Babraham Institute, Babraham Research Campus, Cambridge CB22
> >>>>> 3AT Registered Charity No. 1053902.
> >>>>> The information transmitted in this email is directed only to the
> >>>>> addressee. If you received this in error, please contact the
> >>>>> sender and delete this email from your system. The contents of
> >>>>> this e-mail are the views of the sender and do not necessarily
> >>>>> represent the views of the Babraham Institute. Full conditions at:
> >>>>>
> www.babraham.ac.uk<http://www.babraham.ac.uk/email_disclaimer.html
> >

 

> -----Original Message-----
> From: Confocal Microscopy List
> [mailto:[hidden email]] On Behalf Of George
> McNamara
> Sent: Sunday, September 16, 2012 7:21 PM
> To: [hidden email]
> Subject: Re: Clover and mRuby2 FPs ... Re: Background fluorescence
> problem
>
> *****
> To join, leave or search the confocal microscopy listserv, go to:
> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
> *****
>
>
>> Hi Roger,
>>
>> These are not my FP's!  I read the paper a couple of days ago and
>> thought it worth mentioning to the listserv.
>>
>> The paper states that the plasmids will be available at addgene.org -
>> presumably (ok, hopefully) in sync with the print edition official
>> publication date.
>>
>> If you are in a hurry, you could contact the PI to try to get the
>> plasmids early (i.e. offer to provide your fedex number).
>>
>> I did not see mRuby in addgene.org either. The original mRuby paper is
>> PMID:  19194514.
>>
>> The mRuby2 DNA sequence is available online at NCBI Nucleotide (search
>> term: http://www.ncbi.nlm.nih.gov/nuccore?term=eqFP611     )
>>
>> Synthetic construct red fluorescent protein Ruby2 gene, partial cds
>> </nuccore/JX489389.1>
>>
>> 711 bp linear other-genetic
>>
>> Accession: JX489389.1
>>    GI: 404332617
>>
>> atggtgtcta agggcgaaga gctgatcaag gaaaatatgc gtatgaaggt ggtcatggaa 61
>> ggttcggtca acggccacca attcaaatgc acaggtgaag gagaaggcaa tccgtacatg 121
>> ggaactcaaa ccatgaggat caaagtcatc gagggaggac ccctgccatt tgcctttgac 181
>> attcttgcca cgtcgttcat gtatggcagc cgtactttta tcaagtaccc gaaaggcatt 241
>> cctgatttct ttaaacagtc ctttcctgag ggttttactt gggaaagagt tacgagatac 301
>> gaagatggtg gagtcgtcac cgtcatgcag gacaccagcc ttgaggatgg ctgtctcgtt 361
>> taccacgtcc aagtcagagg ggtaaacttt ccctccaatg gtcccgtgat gcagaagaag 421
>> accaagggtt gggagcctaa tacagagatg atgtatccag cagatggtgg tctgagggga 481
>> tacactcata tggcactgaa agttgatggt ggtggccatc tgtcttgctc tttcgtaaca 541
>> acttacaggt caaaaaagac cgtcgggaac atcaagatgc ccggtatcca tgccgttgat 601
>> caccgcctgg aaaggttaga ggaaagtgac aatgaaatgt tcgtagtaca acgcgaacac 661
>> gcagttgcca agttcgccgg gcttggtggt gggatggacg agctgtacaa g
>>
>>
>> I ran the above mRuby2 DNA sequence through one of the free online
>> codon optimization programs - www.jcat.de   which gave a low CAI score
>> (CAI 0.27) when I asked for human optimization.
>>
>> jcat recommends (CAI 0.96, a typical optimized score):
>>
>> ATGGTGAGCAAGGGCGAGGAGCTGATCAAGGAGAACATGCGCATGAAGGT 50
>> GGTGATGGAGGGCAGCGTGAACGGCCACCAGTTCAAGTGCACCGGCGAGG 100
>> GCGAGGGCAACCCCTACATGGGCACCCAGACCATGCGCATCAAGGTGATC 150
>> GAGGGCGGCCCCCTGCCCTTCGCCTTCGACATCCTGGCCACCAGCTTCAT 200
>> GTACGGCAGCCGCACCTTCATCAAGTACCCCAAGGGCATCCCCGACTTCT 250
>> TCAAGCAGAGCTTCCCCGAGGGCTTCACCTGGGAGCGCGTGACCCGCTAC 300
>> GAGGACGGCGGCGTGGTGACCGTGATGCAGGACACCAGCCTGGAGGACGG 350
>> CTGCCTGGTGTACCACGTGCAGGTGCGCGGCGTGAACTTCCCCAGCAACG 400
>> GCCCCGTGATGCAGAAGAAGACCAAGGGCTGGGAGCCCAACACCGAGATG 450
>> ATGTACCCCGCCGACGGCGGCCTGCGCGGCTACACCCACATGGCCCTGAA 500
>> GGTGGACGGCGGCGGCCACCTGAGCTGCAGCTTCGTGACCACCTACCGCA 550
>> GCAAGAAGACCGTGGGCAACATCAAGATGCCCGGCATCCACGCCGTGGAC 600
>> CACCGCCTGGAGCGCCTGGAGGAGAGCGACAACGAGATGTTCGTGGTGCA 650
>> GCGCGAGCACGCCGTGGCCAAGTTCGCCGGCCTGGGCGGCGGCATGGACG 700
> AGCTGTACAAG
>>
>>
>> Clover sequence is:
>>
>> Synthetic construct *green* *fluorescent* protein Clover gene, partial
>> cds </nuccore/JX489388.1>
>>
>> 684 bp linear other-genetic
>>
>> Accession: JX489388.1
>> GI: 404332615
>>
>> their sequence:
>>
>> 1 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 61
>> ggcgacgtaa acggccacaa gttcagcgtc cgcggcgagg gcgagggcga tgccaccaac 121
>> ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 181
>> ctcgtgacca ccttcggcta cggcgtggcc tgcttcagcc gctaccccga ccacatgaag 241
>> cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatctct 301
>> ttcaaggacg acggtaccta caagacccgc gccgaggtga agttcgaggg cgacaccctg 361
>> gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 421
>> aagctggagt acaacttcaa cagccacaac gtctatatca cggccgacaa gcagaagaac 481
>> ggcatcaagg ctaacttcaa gatccgccac aacgttgagg acggcagcgt gcagctcgcc 541
>> gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 601
>> tacctgagcc atcagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 661
>> ctgctggagt tcgtaaccgc cgcc
>>
>> JCat reported a CAI of 0.79 (1.0 being perfect), and recommended: (CAI
>> 0.956):
>>
>> ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGCGTGGTGCCCATCCTGGT 50
>> GGAGCTGGACGGCGACGTGAACGGCCACAAGTTCAGCGTGCGCGGCGAGG 100
>> GCGAGGGCGACGCCACCAACGGCAAGCTGACCCTGAAGTTCATCTGCACC 150
>> ACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTGGTGACCACCTTCGGCTA 200
>> CGGCGTGGCCTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACT 250
>> TCTTCAAGAGCGCCATGCCCGAGGGCTACGTGCAGGAGCGCACCATCAGC 300
>> TTCAAGGACGACGGCACCTACAAGACCCGCGCCGAGGTGAAGTTCGAGGG 350
>> CGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG 400
>> ACGGCAACATCCTGGGCCACAAGCTGGAGTACAACTTCAACAGCCACAAC 450
>> GTGTACATCACCGCCGACAAGCAGAAGAACGGCATCAAGGCCAACTTCAA 500
>> GATCCGCCACAACGTGGAGGACGGCAGCGTGCAGCTGGCCGACCACTACC 550
>> AGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCAC 600
>> TACCTGAGCCACCAGAGCGCCCTGAGCAAGGACCCCAACGAGAAGCGCGA 650
>> CCACATGGTGCTGCTGGAGTTCGTGACCGCCGCC
>>
>>
>>
>> at 711 bases - each, you might find it cost effective to simply order
>> this (or pick your favorite optimizer ... or optimize for your
>> favorite organism) sequence from some DNA synthesis company.
>>
>> If the company charges by the gene, you could stick in a short linker
>> (see the paper, or use Steven Vogel's sequence in C5V or in between
>> his V's of V6) and have 711+(say)15+711 base sequence synthesized. If
>> you posted that plasmid to addgene.org, and mentioned codon optimized
>> for human (and maybe stuck on a promoter or maximized Gateway
>> compatibility), would probably lead to being your most popular addgene
>> construct and (when you publish it) most referenced technical paper.
>>
>> Enjoy,
>>
>> George
>>
>>
>> On 9/16/2012 12:28 PM, Roger Phillips wrote:
>>> Dear George,
>>> Have you looked at lifetime kinetics in the transfer from Clover to
> mRuby2?  I only have access to the paper copy of Nature Methods so won't
> read the details till next month. We are about to shift from fixed to live cell
> imaging and we need to choose labels for [] and [].  Are the vectors for
> fusion construction and for controls (Clover-mRuby2 tandem construct in
> sup fig 9 and unfused Clover and mRuby2 available?
>>> Thanks for your work,
>>> Roger Phillips
>>>
>>> Dr Roger Guy Phillips
>>> Centre for Advanced Microscopy,
>>> University of Sussex
>>> School of Life Sciences
>>> John Maynard Smith Building
>>> Falmer, Brighton&  Hove
>>> BN1 9QG
>>> United Kingdom
>>>
>>> phone:[phone]
>>> fax: [phone]
>>> email:[hidden email]
>>> room:2C9 (ext 7585)/lab 4C2 (ext 2734)
>>>
>>>
>>>
>>>
>>> -----Original Message-----
>>> From: Confocal Microscopy List
>>> [mailto:[hidden email]] On Behalf Of George
>>> McNamara
>>> Sent: 15 September 2012 01:33
>>> To:[hidden email]
>>> Subject: Clover and mRuby2 FPs ... Re: Background fluorescence
>>> problem
>>>
>>> *****
>>> To join, leave or search the confocal microscopy listserv, go to:
>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>> *****
>>>
>>> Hi Kurt,
>>>
>>> Clover and mruby2 are described in the Lam et al paper at Nature
>>> Methods
>>>
>>>
> http://www.nature.com/nmeth/journal/vaop/ncurrent/full/nmeth.2171.ht
> m
>>> l
>>>
>>> A variety of genetically encoded reporters use changes in
>>> fluorescence (or Förster) resonance energy transfer (FRET) to report on
> biochemical processes in living cells. The standard genetically encoded FRET
> pair consists of CFPs and YFPs, but many CFP-YFP reporters suffer from low
> FRET dynamic range, phototoxicity from the CFP excitation light and
> complex photokinetic events such as reversible photobleaching and
> photoconversion. We engineered two fluorescent proteins, Clover and
> mRuby2, which are the brightest green and red fluorescent proteins to date
> and have the highest Förster radius of any ratiometric FRET pair yet
> described. Replacement of CFP and YFP with these two proteins in reporters
> of kinase activity, small GTPase activity and transmembrane voltage
> significantly improves photostability, FRET dynamic range and emission
> ratio changes. These improvements enhance detection of transient
> biochemical events such as neuronal action-potential firing and RhoA act
> ivation in growth cones.
>>>
>>>
>>>
>>> On 9/14/2012 2:58 PM, Kurt Thorn wrote:
>>>
>>>> *****
>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>> *****
>>>>
>>>> What is Clover GFP? I can't find much information about it on Google.
>>>>
>>>> Thanks,
>>>> Kurt
>>>>
>>>> On 9/14/2012 3:49 AM, George McNamara wrote:
>>>>
>>>>> *****
>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>> *****
>>>>>
>>>>> Hi Simon,
>>>>>
>>>>> Your cells might not need the 100x excess of riboflavin present in
>>>>> "standard" DMEM, your background could be reduced. The Essen tech
>>>>> note I mentioned lists:
>>>>> DMEM 0.4 mg/L riboflavin ... 43.6 units fluorescence
>>>>> Eagles MEM 0.1 mg/mL     ... 12.9
>>>>> F12K            0.04               ... 5.4
>>>>> EBM             0.004             ... 3.7
>>>>> Riboflavin (alone) 0.4          ... 58.7 (perhaps suggesting that
>>>>> culture media quenches riboflavin or it gets converted in part to
>>>>> something less fluorescent?) Contact Essen if you want the entire
>>>>> tech note.
>>>>>
>>>>>
>>>>> If you absolutely require a green fluorescent protein, spend the
>>>>> time to switch to the new Clover or "V6" from Steven Vogel
>>>>> (available from addgene.org as VVVVVV).
>>>>> If you do not need green, switch to tdTomato or the new mRuby2.
>>>>>
>>>>>
>>>>>
>>>>> Create File
>>>>> Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. [Epub ahead of
>>>>> print]
>>>>>
>>>>>
>>>>>  Improving FRET dynamic range with bright green and red
>>>>> fluorescent proteins.
>>>>>
>>>>> Lam AJ (et al)
>>>>>
>>>>>      Abstract
>>>>>
>>>>> A variety of genetically encoded reporters use changes in
>>>>> fluorescence resonance energy transfer (FRET) to report on
>>>>> biochemical processes in living cells. The standard genetically
>>>>> encoded FRET pair consists of CFPs and YFPs, but many CFP-YFP
>>>>> reporters suffer from low FRET dynamic range, phototoxicity from
>>>>> the CFP excitation light and complex photokinetic events such as
>>>>> reversible photobleaching and photoconversion. We engineered two
>>>>> fluorescent proteins,* Clover and mRuby2*, which are the brightest
>>>>> green and red fluorescent proteins to date and have the highest
>>>>> Förster radius of any ratiometric FRET pair yet described.
>>>>> Replacement of CFP and YFP with these two proteins in reporters of
>>>>> kinase activity, small GTPase activity and transmembrane voltage
>>>>> significantly improves photostability, FRET dynamic range and
>>>>> emission ratio changes. These improvements enhance detection of
>>>>> transient biochemical events such as neuronal action-potential
>>>>> firing and RhoA activation in growth cones.
>>>>>
>>>>> PMID:
>>>>>    22961245
>>>>>
>>>>>
>>>>> PLoS One.<#>  2012;7(5):e38209. Epub 2012 May 30.
>>>>>
>>>>>
>>>>>  Fluorescence polarization and fluctuation analysis monitors
>>>>> subunit proximity, stoichiometry, and protein complex hydrodynamics.
>>>>>
>>>>> Nguyen TA ...  Vogel SS
>>>>>
>>>>>      Abstract
>>>>>
>>>>> Förster resonance energy transfer (FRET) microscopy is frequently
>>>>> used to study protein interactions and conformational changes in
>>>>> living cells. The utility of FRET is limited by false positive and
>>>>> negative signals. To overcome these limitations we have developed
>>>>> Fluorescence Polarization and Fluctuation Analysis (FPFA), a hybrid
>>>>> single-molecule based method combining time-resolved fluorescence
>>>>> anisotropy (homo-FRET) and fluorescence correlation spectroscopy.
>>>>> Using FPFA, homo-FRET (a 1-10 nm proximity gauge), brightness (a
>>>>> measure of the number of fluorescent subunits in a complex), and
>>>>> correlation time (an attribute sensitive to the mass and shape of a
>>>>> protein complex) can be simultaneously measured. These
> measurements
>>>>> together rigorously constrain the interpretation of FRET signals.
>>>>> Venus based control-constructs were used to validate FPFA. The
>>>>> utility of FPFA was demonstrated by measuring in living cells the
>>>>> number of subunits in the ?-isoform of Venus-tagged
>>>>> calcium-calmodulin dependent protein kinase-II (CaMKII?)
> holoenzyme.
>>>>> Brightness analysis revealed that the holoenzyme has, on average,
>>>>> 11.9 ± 1.2 subunit, but values ranged from 10-14 in individual cells.
>>>>> Homo-FRET analysis simultaneously detected that catalytic domains
>>>>> were arranged as dimers in the dodecameric holoenzyme, and this
>>>>> paired organization was confirmed by quantitative hetero-FRET
>>>>> analysis. In freshly prepared cell homogenates FPFA detected only
>>>>> 10.2 ± 1.3 subunits in the holoenzyme with values ranging from 9-12.
>>>>> Despite the reduction in subunit number, catalytic domains were
>>>>> still arranged as pairs in homogenates. Thus, FPFA suggests that
>>>>> while the absolute number of subunits in an auto-inhibited
>>>>> holoenzyme might vary from cell to cell, the organization of
>>>>> catalytic domains into pairs is preserved.
>>>>>
>>>>> PMID:
>>>>>    22666486
>>>>>
>>>>>
>>>>> I am a bit disappointed Vogel's group did not go for V8 (a well
>>>>> known
>>>>> drink) or V12 - the latter either as a polypeptide or with
>>>>> inducible dimerization domain. V12 since the goal of this paper is
>>>>> to quantify the number of subunits in CaMKIIalpha, which turns out
>>>>> to be 12 (+/- a few) as described in
>>>>> http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3364239/figure/pone-
> 003
>>>>> 82
>>>>> 09-g004/
>>>>>
>>>>>
>>>>> On 9/14/2012 4:32 AM, simon walker wrote:
>>>>>
>>>>>> *****
>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>> *****
>>>>>>
>>>>>> Thanks for the various responses.  Yes, I'd seen the Bogdanov
>>>>>> paper and the Evrogen medium and thought that might be worth a
>>>>>> try.  The problem we have is that for our assay the culture medium
>>>>>> is absolutely critical (it's not just a case of keeping cells
>>>>>> alive), so we can't use a minimal HEPES-based buffer.  I am
>>>>>> interested to know what is in the 'BackDrop' solution.  We can't
>>>>>> use it unless we're fairly confident it's not going to affect our assay.
>>>>>> Simon
>>>>>>
>>>>>>
>>>>>> -----Original Message-----
>>>>>> From: Confocal Microscopy List
>>>>>> [mailto:[hidden email]] On Behalf Of
> George
>>>>>> McNamara
>>>>>> Sent: 14 September 2012 01:57
>>>>>> To:[hidden email]
>>>>>> Subject: Re: Background fluorescence problem
>>>>>>
>>>>>> *****
>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>> *****
>>>>>>
>>>>>> Hi Simon,
>>>>>>
>>>>>> likely riboflavin and possibly other flavins. See
>>>>>>
> http://www.evrogen.com/products/medium_DMEM_gfp/medium_DMEM_
> gfp.sh
>>>>>> tm l and the Bogdanov et al paper referenced  at the bottom of the
>>>>>> page;
>>>>>>
>>>>>>      * Bogdanov AM, Bogdanova EA, Chudakov DM, Gorodnicheva TV,
>>>>>> Lukyanov
>>>>>>        S, Lukyanov KA. Cell culture medium affects GFP
>>>>>> photostability: a
>>>>>>        solution. Nat Methods. 2009; 6 (12):859-60. / pmid:
>>>>>> 19935837
>>>>>>
> <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Pub
>>>>>> Me d&list_uids=19935837&dopt=Abstract>
>>>>>>
>>>>>>
>>>>>>
>>>>>> Their solution: incubate cells in miedia without (or with low, if
>>>>>> needed) riboflavin for a day.
>>>>>>
>>>>>> As a bonus, riboflavin quenches (FRET?) and/or transiently
>>>>>> photoconverts GFP to red fluorescence (might be mostly dark states):
>>>>>>
>>>>>> Condensed mitotic chromosome structure at nanometer resolution
>>>>>> using PALM and EGFP- histones.</pubmed/20856676>* Matsuda* A,
> Shao
>>>>>> L, Boulanger J, Kervrann C, Carlton PM, Kner P, Agard D, *Sedat* JW.
>>>>>> PLoS One. 2010 Sep 15;5(9):e12768. PMID: 20856676
>>>>>>
>>>>>>
>>>>>> If you contact Essen Biosciences, they will (hopefully) give you a
>>>>>> copy of their application note on the concentrations of riboflavin
>>>>>> in many culture media and correlation with fluorescence of those
>>>>>> media. Speaking of Essen - they finally introduced a dual
>>>>>> green+red fluorescence Incucyte.
>>>>>>
>>>>>> Enjoy,
>>>>>>
>>>>>> George
>>>>>>
>>>>>>
>>>>>>
>>>>>> On 9/13/2012 11:04 AM, Simon Walker wrote:
>>>>>>
>>>>>>> *****
>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>>> *****
>>>>>>>
>>>>>>> Dear List,
>>>>>>> We are imaging very weakly fluorescent live cells (expressing
>>>>>>> GFP) on a wide- field system and having issues with a source of
>>>>>>> background fluorescence.
>>>>>>> When we look at our cells under epi-illumination we see a rapid
>>>>>>> drop in a weak background signal (not where the cells are) that
>>>>>>> fully recovers over a ~10 s period after the illumination light
>>>>>>> is switched off.  Our experiments require the use of DMEM as the
>>>>>>> imaging medium and this is the likely cause of problem.  It
>>>>>>> appears that something in the medium is sticking to the
>>>>>>> coverglass.  It's not phenol red as the effect is seen with both
>>>>>>> phenol red-containing and phenol- red-free DMEM.  Does anyone
>>>>>>> know what else it could be?  Has anyone else seen anything
>>>>>>> similar?  We're wondering if it could be riboflavin which is in the
> DMEM we're using.  Would this stick to glass?
>>>>>>>
>>>>>>> I've seen that Life Technologies now market a substance that
>>>>>>> allegedly surpresses background fluorescence in DMEM:
>>>>>>> http://products.invitrogen.com/ivgn/product/R37603
>>>>>>> Has anyone tried this?  Does anyone know how it works?
>>>>>>>
>>>>>>> Thanks,
>>>>>>> Simon
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>> The Babraham Institute, Babraham Research Campus, Cambridge CB22
>>>>>> 3AT Registered Charity No. 1053902.
>>>>>> The information transmitted in this email is directed only to the
>>>>>> addressee. If you received this in error, please contact the
>>>>>> sender and delete this email from your system. The contents of
>>>>>> this e-mail are the views of the sender and do not necessarily
>>>>>> represent the views of the Babraham Institute. Full conditions at:
>>>>>>
> www.babraham.ac.uk<http://www.babraham.ac.uk/email_disclaimer.html
>>

[Dolphin, Colin]

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

We spent sometime designing codon-optimized FPs for expression in C.
elegans and found, in two out of three cases, that in otherwise equivalent
transgenic animals, codon-optimized FP expression was severely compromised
in comparison to the 'established' coding sequences that had been, and
still are, used in worms since their initial development as reporters. As
well as being different with respect to codon use our 'codon-optimized'
sequences had two, unequally spaced artificial introns whereas the
otherwise equivalent but non 'codon-optimized' coding sequences all had
three equally spaced introns. We might just have been unlucky but I think
there are other variables - such as use, number and placement of introns -
that may as important, if not more so. 'Codon-optimization' may not be the
only thing to consider and, as such, in some situations it may be a case
of 'if it aint broke don't fix it'!
 


Colin

On 17/10/2012 10:54, "Tobias Rose" <[hidden email]> wrote:

>*****
>To join, leave or search the confocal microscopy listserv, go to:
>http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>*****
>
>Hi everybody,
>
>Sorry to warm up this old thread and please excuse the lengthy post - but
>I am about to do precisely what George suggested: Synthesize mRuby2.
>(well: without the publish to addgene and try to snatch citations away
>from R. Tsien bit...). And by the way: All plasmids from that publication
>are available on addgene now: http://www.addgene.org/browse/article/5906/
>.
>Be aware that there are quite a few tags on the N-terminus of mRuby2...
>
>The question that I am asking myself for a while now is:
>Is codon optimization really worth it?
>
>Due to lack of time and to increase turnover I am by now synthesizing
>most of my DNA. With the breakneck speed that fluorescent proteins and
>genetically encoded functional indicators are developed right now it's
>almost impossible to keep up without synthesis. And it¹s also very
>convenient...
>
>However: besides all the PR talk of synthesis companies I don't really
>know if codon optimization (for mouse in my case) would do more harm than
>good. For instance, next to all the semi-anecdotal optimization papers
>out there there is still this Science paper here:
>
>Coding-Sequence Determinants of Gene Expression in Escherichia coli
>Grzegorz Kudla, Andrew W. Murray, David Tollervey, and Joshua B. Plotkin
>Science 10 April 2009: 324 (5924), 255-258. [DOI:10.1126/science.1170160]
>
>At least in e. coli codon usage appears to not matter at all (see also
>discussion here:
>http://omicsomics.blogspot.de/2009/04/is-codon-optimization-bunk.html ).
>
>Also, even though I cannot judge it, it's stated in my 'AAV cookbook':
>"[...It should be noted, however, that the potential for introduction of
>sequences that negatively affect gene expression is also a risk with this
>process, and it is difficult to predict which sequences will have such an
>effect. For example, it has been shown that the sequences coding for
>protein domain boundaries are more likely to be coded by ³translationally
>slow² codons [...]"
>Gray, J. T. & Zolotukhin, S. Adeno-Associated Virus. 807, 25­46 (2011).
>
>Right now I don't even know if the run of the mill XFPs available from
>addgene or Tsien himself _are_ in any way codon-optimized away from the
>original species towards mammalian use.
>
>Whould you say that it makes sense, for example, to further 'optimize'
>very established sequences like standard XFPs (in my case for tdtomato
>and GCaMPx (genetically-encoded Ca2+ indicator [GFP + calmodulin +
>M13peptide])?  The problem with the CAI score that George posted (next to
>the fact that that's only one out of many ways to codon optimize) is that
>I'm getting entirely different CAI scores from different calculators and
>especially also for different mammalian species  (e.g. human vs. mouse -
>is codon usage really that different here?):
>
>Example:
>mRUBY2 CDS
>
>www.jcat.de
>human
>before opt:
>CAI 0.27
>
>After opt:
>CAI 0.95
>
>Mouse (my target):
>before opt
>CAI 0.23
>
>after opt:
>CAI 0.72
>
>Same sequence with genscript:
>http://www.genscript.com/cgi-bin/tools/rare_codon_analysis
>
>human
>before opt
>CAI : 0.75
>
>Mouse
>before opt
>CAI : 0.75
>
>As usual, optimisation is proprietary hereŠ and might be biased towards
>ease of synthesis and not necessary towards best possible expression.
>
>And then there is the entirely different optimization from other
>companies like DNA2.0...
>
>What is your opinion: voodoo or not? Would you change 'established'
>sequences to increase expression - or would you just optimize when you
>switch species?
>
>Thanks,T
>
>Also: What's your bet - is mRuby2 the best red/orange protein ever -- or
>would you still use mCherry or (td)tomato in spite of all the
>cytotoxicity rumours?
>
>
>
>
>
>
>> -----Original Message-----
>> From: Confocal Microscopy List
>> [mailto:[hidden email]] On Behalf Of George
>> McNamara
>> Sent: Sunday, September 16, 2012 7:21 PM
>> To: [hidden email]
>> Subject: Re: Clover and mRuby2 FPs ... Re: Background fluorescence
>> problem
>>
>> *****
>> To join, leave or search the confocal microscopy listserv, go to:
>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> *****
>>
>>
>> > Hi Roger,
>> >
>> > These are not my FP's!  I read the paper a couple of days ago and
>> > thought it worth mentioning to the listserv.
>> >
>> > The paper states that the plasmids will be available at addgene.org -
>> > presumably (ok, hopefully) in sync with the print edition official
>> > publication date.
>> >
>> > If you are in a hurry, you could contact the PI to try to get the
>> > plasmids early (i.e. offer to provide your fedex number).
>> >
>> > I did not see mRuby in addgene.org either. The original mRuby paper is
>> > PMID:  19194514.
>> >
>> > The mRuby2 DNA sequence is available online at NCBI Nucleotide (search
>> > term: http://www.ncbi.nlm.nih.gov/nuccore?term=eqFP611      )
>> >
>> > Synthetic construct red fluorescent protein Ruby2 gene, partial cds
>> > </nuccore/JX489389.1>
>> >
>> > 711 bp linear other-genetic
>> >
>> > Accession: JX489389.1
>> >     GI: 404332617
>> >
>> > atggtgtcta agggcgaaga gctgatcaag gaaaatatgc gtatgaaggt ggtcatggaa 61
>> > ggttcggtca acggccacca attcaaatgc acaggtgaag gagaaggcaa tccgtacatg 121
>> > ggaactcaaa ccatgaggat caaagtcatc gagggaggac ccctgccatt tgcctttgac 181
>> > attcttgcca cgtcgttcat gtatggcagc cgtactttta tcaagtaccc gaaaggcatt 241
>> > cctgatttct ttaaacagtc ctttcctgag ggttttactt gggaaagagt tacgagatac 301
>> > gaagatggtg gagtcgtcac cgtcatgcag gacaccagcc ttgaggatgg ctgtctcgtt 361
>> > taccacgtcc aagtcagagg ggtaaacttt ccctccaatg gtcccgtgat gcagaagaag 421
>> > accaagggtt gggagcctaa tacagagatg atgtatccag cagatggtgg tctgagggga 481
>> > tacactcata tggcactgaa agttgatggt ggtggccatc tgtcttgctc tttcgtaaca 541
>> > acttacaggt caaaaaagac cgtcgggaac atcaagatgc ccggtatcca tgccgttgat 601
>> > caccgcctgg aaaggttaga ggaaagtgac aatgaaatgt tcgtagtaca acgcgaacac 661
>> > gcagttgcca agttcgccgg gcttggtggt gggatggacg agctgtacaa g
>> >
>> >
>> > I ran the above mRuby2 DNA sequence through one of the free online
>> > codon optimization programs - www.jcat.de   which gave a low CAI score
>> > (CAI 0.27) when I asked for human optimization.
>> >
>> > jcat recommends (CAI 0.96, a typical optimized score):
>> >
>> > ATGGTGAGCAAGGGCGAGGAGCTGATCAAGGAGAACATGCGCATGAAGGT 50
>> > GGTGATGGAGGGCAGCGTGAACGGCCACCAGTTCAAGTGCACCGGCGAGG 100
>> > GCGAGGGCAACCCCTACATGGGCACCCAGACCATGCGCATCAAGGTGATC 150
>> > GAGGGCGGCCCCCTGCCCTTCGCCTTCGACATCCTGGCCACCAGCTTCAT 200
>> > GTACGGCAGCCGCACCTTCATCAAGTACCCCAAGGGCATCCCCGACTTCT 250
>> > TCAAGCAGAGCTTCCCCGAGGGCTTCACCTGGGAGCGCGTGACCCGCTAC 300
>> > GAGGACGGCGGCGTGGTGACCGTGATGCAGGACACCAGCCTGGAGGACGG 350
>> > CTGCCTGGTGTACCACGTGCAGGTGCGCGGCGTGAACTTCCCCAGCAACG 400
>> > GCCCCGTGATGCAGAAGAAGACCAAGGGCTGGGAGCCCAACACCGAGATG 450
>> > ATGTACCCCGCCGACGGCGGCCTGCGCGGCTACACCCACATGGCCCTGAA 500
>> > GGTGGACGGCGGCGGCCACCTGAGCTGCAGCTTCGTGACCACCTACCGCA 550
>> > GCAAGAAGACCGTGGGCAACATCAAGATGCCCGGCATCCACGCCGTGGAC 600
>> > CACCGCCTGGAGCGCCTGGAGGAGAGCGACAACGAGATGTTCGTGGTGCA 650
>> > GCGCGAGCACGCCGTGGCCAAGTTCGCCGGCCTGGGCGGCGGCATGGACG 700
>> AGCTGTACAAG
>> >
>> >
>> > Clover sequence is:
>> >
>> > Synthetic construct *green* *fluorescent* protein Clover gene, partial
>> > cds </nuccore/JX489388.1>
>> >
>> > 684 bp linear other-genetic
>> >
>> > Accession: JX489388.1
>> > GI: 404332615
>> >
>> > their sequence:
>> >
>> > 1 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 61
>> > ggcgacgtaa acggccacaa gttcagcgtc cgcggcgagg gcgagggcga tgccaccaac 121
>> > ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 181
>> > ctcgtgacca ccttcggcta cggcgtggcc tgcttcagcc gctaccccga ccacatgaag 241
>> > cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatctct 301
>> > ttcaaggacg acggtaccta caagacccgc gccgaggtga agttcgaggg cgacaccctg 361
>> > gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 421
>> > aagctggagt acaacttcaa cagccacaac gtctatatca cggccgacaa gcagaagaac 481
>> > ggcatcaagg ctaacttcaa gatccgccac aacgttgagg acggcagcgt gcagctcgcc 541
>> > gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 601
>> > tacctgagcc atcagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 661
>> > ctgctggagt tcgtaaccgc cgcc
>> >
>> > JCat reported a CAI of 0.79 (1.0 being perfect), and recommended: (CAI
>> > 0.956):
>> >
>> > ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGCGTGGTGCCCATCCTGGT 50
>> > GGAGCTGGACGGCGACGTGAACGGCCACAAGTTCAGCGTGCGCGGCGAGG 100
>> > GCGAGGGCGACGCCACCAACGGCAAGCTGACCCTGAAGTTCATCTGCACC 150
>> > ACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTGGTGACCACCTTCGGCTA 200
>> > CGGCGTGGCCTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACT 250
>> > TCTTCAAGAGCGCCATGCCCGAGGGCTACGTGCAGGAGCGCACCATCAGC 300
>> > TTCAAGGACGACGGCACCTACAAGACCCGCGCCGAGGTGAAGTTCGAGGG 350
>> > CGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG 400
>> > ACGGCAACATCCTGGGCCACAAGCTGGAGTACAACTTCAACAGCCACAAC 450
>> > GTGTACATCACCGCCGACAAGCAGAAGAACGGCATCAAGGCCAACTTCAA 500
>> > GATCCGCCACAACGTGGAGGACGGCAGCGTGCAGCTGGCCGACCACTACC 550
>> > AGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCAC 600
>> > TACCTGAGCCACCAGAGCGCCCTGAGCAAGGACCCCAACGAGAAGCGCGA 650
>> > CCACATGGTGCTGCTGGAGTTCGTGACCGCCGCC
>> >
>> >
>> >
>> > at 711 bases - each, you might find it cost effective to simply order
>> > this (or pick your favorite optimizer ... or optimize for your
>> > favorite organism) sequence from some DNA synthesis company.
>> >
>> > If the company charges by the gene, you could stick in a short linker
>> > (see the paper, or use Steven Vogel's sequence in C5V or in between
>> > his V's of V6) and have 711+(say)15+711 base sequence synthesized. If
>> > you posted that plasmid to addgene.org, and mentioned codon optimized
>> > for human (and maybe stuck on a promoter or maximized Gateway
>> > compatibility), would probably lead to being your most popular addgene
>> > construct and (when you publish it) most referenced technical paper.
>> >
>> > Enjoy,
>> >
>> > George
>> >
>> >
>> > On 9/16/2012 12:28 PM, Roger Phillips wrote:
>> >> Dear George,
>> >> Have you looked at lifetime kinetics in the transfer from Clover to
>> mRuby2?  I only have access to the paper copy of Nature Methods so won't
>> read the details till next month. We are about to shift from fixed to
>>live cell
>> imaging and we need to choose labels for [] and [].  Are the vectors for
>> fusion construction and for controls (Clover-mRuby2 tandem construct in
>> sup fig 9 and unfused Clover and mRuby2 available?
>> >> Thanks for your work,
>> >> Roger Phillips
>> >>
>> >> Dr Roger Guy Phillips
>> >> Centre for Advanced Microscopy,
>> >> University of Sussex
>> >> School of Life Sciences
>> >> John Maynard Smith Building
>> >> Falmer, Brighton&  Hove
>> >> BN1 9QG
>> >> United Kingdom
>> >>
>> >> phone:[phone]
>> >> fax: [phone]
>> >> email:[hidden email]
>> >> room:2C9 (ext 7585)/lab 4C2 (ext 2734)
>> >>
>> >>
>> >>
>> >>
>> >> -----Original Message-----
>> >> From: Confocal Microscopy List
>> >> [mailto:[hidden email]] On Behalf Of George
>> >> McNamara
>> >> Sent: 15 September 2012 01:33
>> >> To:[hidden email]
>> >> Subject: Clover and mRuby2 FPs ... Re: Background fluorescence
>> >> problem
>> >>
>> >> *****
>> >> To join, leave or search the confocal microscopy listserv, go to:
>> >> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> >> *****
>> >>
>> >> Hi Kurt,
>> >>
>> >> Clover and mruby2 are described in the Lam et al paper at Nature
>> >> Methods
>> >>
>> >>
>> http://www.nature.com/nmeth/journal/vaop/ncurrent/full/nmeth.2171.ht
>> m
>> >> l
>> >>
>> >> A variety of genetically encoded reporters use changes in
>> >> fluorescence (or Förster) resonance energy transfer (FRET) to report
>>on
>> biochemical processes in living cells. The standard genetically encoded
>>FRET
>> pair consists of CFPs and YFPs, but many CFP-YFP reporters suffer from
>>low
>> FRET dynamic range, phototoxicity from the CFP excitation light and
>> complex photokinetic events such as reversible photobleaching and
>> photoconversion. We engineered two fluorescent proteins, Clover and
>> mRuby2, which are the brightest green and red fluorescent proteins to
>>date
>> and have the highest Förster radius of any ratiometric FRET pair yet
>> described. Replacement of CFP and YFP with these two proteins in
>>reporters
>> of kinase activity, small GTPase activity and transmembrane voltage
>> significantly improves photostability, FRET dynamic range and emission
>> ratio changes. These improvements enhance detection of transient
>> biochemical events such as neuronal action-potential firing and RhoA act
>> ivation in growth cones.
>> >>
>> >>
>> >>
>> >> On 9/14/2012 2:58 PM, Kurt Thorn wrote:
>> >>
>> >>> *****
>> >>> To join, leave or search the confocal microscopy listserv, go to:
>> >>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> >>> *****
>> >>>
>> >>> What is Clover GFP? I can't find much information about it on
>>Google.
>> >>>
>> >>> Thanks,
>> >>> Kurt
>> >>>
>> >>> On 9/14/2012 3:49 AM, George McNamara wrote:
>> >>>
>> >>>> *****
>> >>>> To join, leave or search the confocal microscopy listserv, go to:
>> >>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> >>>> *****
>> >>>>
>> >>>> Hi Simon,
>> >>>>
>> >>>> Your cells might not need the 100x excess of riboflavin present in
>> >>>> "standard" DMEM, your background could be reduced. The Essen tech
>> >>>> note I mentioned lists:
>> >>>> DMEM 0.4 mg/L riboflavin ... 43.6 units fluorescence
>> >>>> Eagles MEM 0.1 mg/mL     ... 12.9
>> >>>> F12K            0.04               ... 5.4
>> >>>> EBM             0.004             ... 3.7
>> >>>> Riboflavin (alone) 0.4          ... 58.7 (perhaps suggesting that
>> >>>> culture media quenches riboflavin or it gets converted in part to
>> >>>> something less fluorescent?) Contact Essen if you want the entire
>> >>>> tech note.
>> >>>>
>> >>>>
>> >>>> If you absolutely require a green fluorescent protein, spend the
>> >>>> time to switch to the new Clover or "V6" from Steven Vogel
>> >>>> (available from addgene.org as VVVVVV).
>> >>>> If you do not need green, switch to tdTomato or the new mRuby2.
>> >>>>
>> >>>>
>> >>>>
>> >>>> Create File
>> >>>> Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. [Epub ahead of
>> >>>> print]
>> >>>>
>> >>>>
>> >>>>   Improving FRET dynamic range with bright green and red
>> >>>> fluorescent proteins.
>> >>>>
>> >>>> Lam AJ (et al)
>> >>>>
>> >>>>       Abstract
>> >>>>
>> >>>> A variety of genetically encoded reporters use changes in
>> >>>> fluorescence resonance energy transfer (FRET) to report on
>> >>>> biochemical processes in living cells. The standard genetically
>> >>>> encoded FRET pair consists of CFPs and YFPs, but many CFP-YFP
>> >>>> reporters suffer from low FRET dynamic range, phototoxicity from
>> >>>> the CFP excitation light and complex photokinetic events such as
>> >>>> reversible photobleaching and photoconversion. We engineered two
>> >>>> fluorescent proteins,* Clover and mRuby2*, which are the brightest
>> >>>> green and red fluorescent proteins to date and have the highest
>> >>>> Förster radius of any ratiometric FRET pair yet described.
>> >>>> Replacement of CFP and YFP with these two proteins in reporters of
>> >>>> kinase activity, small GTPase activity and transmembrane voltage
>> >>>> significantly improves photostability, FRET dynamic range and
>> >>>> emission ratio changes. These improvements enhance detection of
>> >>>> transient biochemical events such as neuronal action-potential
>> >>>> firing and RhoA activation in growth cones.
>> >>>>
>> >>>> PMID:
>> >>>>     22961245
>> >>>>
>> >>>>
>> >>>> PLoS One.<#>  2012;7(5):e38209. Epub 2012 May 30.
>> >>>>
>> >>>>
>> >>>>   Fluorescence polarization and fluctuation analysis monitors
>> >>>> subunit proximity, stoichiometry, and protein complex
>>hydrodynamics.
>> >>>>
>> >>>> Nguyen TA ...  Vogel SS
>> >>>>
>> >>>>       Abstract
>> >>>>
>> >>>> Förster resonance energy transfer (FRET) microscopy is frequently
>> >>>> used to study protein interactions and conformational changes in
>> >>>> living cells. The utility of FRET is limited by false positive and
>> >>>> negative signals. To overcome these limitations we have developed
>> >>>> Fluorescence Polarization and Fluctuation Analysis (FPFA), a hybrid
>> >>>> single-molecule based method combining time-resolved fluorescence
>> >>>> anisotropy (homo-FRET) and fluorescence correlation spectroscopy.
>> >>>> Using FPFA, homo-FRET (a 1-10 nm proximity gauge), brightness (a
>> >>>> measure of the number of fluorescent subunits in a complex), and
>> >>>> correlation time (an attribute sensitive to the mass and shape of a
>> >>>> protein complex) can be simultaneously measured. These
>> measurements
>> >>>> together rigorously constrain the interpretation of FRET signals.
>> >>>> Venus based control-constructs were used to validate FPFA. The
>> >>>> utility of FPFA was demonstrated by measuring in living cells the
>> >>>> number of subunits in the ?-isoform of Venus-tagged
>> >>>> calcium-calmodulin dependent protein kinase-II (CaMKII?)
>> holoenzyme.
>> >>>> Brightness analysis revealed that the holoenzyme has, on average,
>> >>>> 11.9 ± 1.2 subunit, but values ranged from 10-14 in individual
>>cells.
>> >>>> Homo-FRET analysis simultaneously detected that catalytic domains
>> >>>> were arranged as dimers in the dodecameric holoenzyme, and this
>> >>>> paired organization was confirmed by quantitative hetero-FRET
>> >>>> analysis. In freshly prepared cell homogenates FPFA detected only
>> >>>> 10.2 ± 1.3 subunits in the holoenzyme with values ranging from
>>9-12.
>> >>>> Despite the reduction in subunit number, catalytic domains were
>> >>>> still arranged as pairs in homogenates. Thus, FPFA suggests that
>> >>>> while the absolute number of subunits in an auto-inhibited
>> >>>> holoenzyme might vary from cell to cell, the organization of
>> >>>> catalytic domains into pairs is preserved.
>> >>>>
>> >>>> PMID:
>> >>>>     22666486
>> >>>>
>> >>>>
>> >>>> I am a bit disappointed Vogel's group did not go for V8 (a well
>> >>>> known
>> >>>> drink) or V12 - the latter either as a polypeptide or with
>> >>>> inducible dimerization domain. V12 since the goal of this paper is
>> >>>> to quantify the number of subunits in CaMKIIalpha, which turns out
>> >>>> to be 12 (+/- a few) as described in
>> >>>> http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3364239/figure/pone-
>> 003
>> >>>> 82
>> >>>> 09-g004/
>> >>>>
>> >>>>
>> >>>> On 9/14/2012 4:32 AM, simon walker wrote:
>> >>>>
>> >>>>> *****
>> >>>>> To join, leave or search the confocal microscopy listserv, go to:
>> >>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> >>>>> *****
>> >>>>>
>> >>>>> Thanks for the various responses.  Yes, I'd seen the Bogdanov
>> >>>>> paper and the Evrogen medium and thought that might be worth a
>> >>>>> try.  The problem we have is that for our assay the culture medium
>> >>>>> is absolutely critical (it's not just a case of keeping cells
>> >>>>> alive), so we can't use a minimal HEPES-based buffer.  I am
>> >>>>> interested to know what is in the 'BackDrop' solution.  We can't
>> >>>>> use it unless we're fairly confident it's not going to affect our
>>assay.
>> >>>>> Simon
>> >>>>>
>> >>>>>
>> >>>>> -----Original Message-----
>> >>>>> From: Confocal Microscopy List
>> >>>>> [mailto:[hidden email]] On Behalf Of
>> George
>> >>>>> McNamara
>> >>>>> Sent: 14 September 2012 01:57
>> >>>>> To:[hidden email]
>> >>>>> Subject: Re: Background fluorescence problem
>> >>>>>
>> >>>>> *****
>> >>>>> To join, leave or search the confocal microscopy listserv, go to:
>> >>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> >>>>> *****
>> >>>>>
>> >>>>> Hi Simon,
>> >>>>>
>> >>>>> likely riboflavin and possibly other flavins. See
>> >>>>>
>> http://www.evrogen.com/products/medium_DMEM_gfp/medium_DMEM_
>> gfp.sh
>> >>>>> tm l and the Bogdanov et al paper referenced  at the bottom of the
>> >>>>> page;
>> >>>>>
>> >>>>>       * Bogdanov AM, Bogdanova EA, Chudakov DM, Gorodnicheva TV,
>> >>>>> Lukyanov
>> >>>>>         S, Lukyanov KA. Cell culture medium affects GFP
>> >>>>> photostability: a
>> >>>>>         solution. Nat Methods. 2009; 6 (12):859-60. / pmid:
>> >>>>> 19935837
>> >>>>>
>> <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Pub
>> >>>>> Me d&list_uids=19935837&dopt=Abstract>
>> >>>>>
>> >>>>>
>> >>>>>
>> >>>>> Their solution: incubate cells in miedia without (or with low, if
>> >>>>> needed) riboflavin for a day.
>> >>>>>
>> >>>>> As a bonus, riboflavin quenches (FRET?) and/or transiently
>> >>>>> photoconverts GFP to red fluorescence (might be mostly dark
>>states):
>> >>>>>
>> >>>>> Condensed mitotic chromosome structure at nanometer resolution
>> >>>>> using PALM and EGFP- histones.</pubmed/20856676>* Matsuda* A,
>> Shao
>> >>>>> L, Boulanger J, Kervrann C, Carlton PM, Kner P, Agard D, *Sedat*
>>JW.
>> >>>>> PLoS One. 2010 Sep 15;5(9):e12768. PMID: 20856676
>> >>>>>
>> >>>>>
>> >>>>> If you contact Essen Biosciences, they will (hopefully) give you a
>> >>>>> copy of their application note on the concentrations of riboflavin
>> >>>>> in many culture media and correlation with fluorescence of those
>> >>>>> media. Speaking of Essen - they finally introduced a dual
>> >>>>> green+red fluorescence Incucyte.
>> >>>>>
>> >>>>> Enjoy,
>> >>>>>
>> >>>>> George
>> >>>>>
>> >>>>>
>> >>>>>
>> >>>>> On 9/13/2012 11:04 AM, Simon Walker wrote:
>> >>>>>
>> >>>>>> *****
>> >>>>>> To join, leave or search the confocal microscopy listserv, go to:
>> >>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> >>>>>> *****
>> >>>>>>
>> >>>>>> Dear List,
>> >>>>>> We are imaging very weakly fluorescent live cells (expressing
>> >>>>>> GFP) on a wide- field system and having issues with a source of
>> >>>>>> background fluorescence.
>> >>>>>> When we look at our cells under epi-illumination we see a rapid
>> >>>>>> drop in a weak background signal (not where the cells are) that
>> >>>>>> fully recovers over a ~10 s period after the illumination light
>> >>>>>> is switched off.  Our experiments require the use of DMEM as the
>> >>>>>> imaging medium and this is the likely cause of problem.  It
>> >>>>>> appears that something in the medium is sticking to the
>> >>>>>> coverglass.  It's not phenol red as the effect is seen with both
>> >>>>>> phenol red-containing and phenol- red-free DMEM.  Does anyone
>> >>>>>> know what else it could be?  Has anyone else seen anything
>> >>>>>> similar?  We're wondering if it could be riboflavin which is in
>>the
>> DMEM we're using.  Would this stick to glass?
>> >>>>>>
>> >>>>>> I've seen that Life Technologies now market a substance that
>> >>>>>> allegedly surpresses background fluorescence in DMEM:
>> >>>>>> http://products.invitrogen.com/ivgn/product/R37603
>> >>>>>> Has anyone tried this?  Does anyone know how it works?
>> >>>>>>
>> >>>>>> Thanks,
>> >>>>>> Simon
>> >>>>>>
>> >>>>>>
>> >>>>>>
>> >>>>> The Babraham Institute, Babraham Research Campus, Cambridge CB22
>> >>>>> 3AT Registered Charity No. 1053902.
>> >>>>> The information transmitted in this email is directed only to the
>> >>>>> addressee. If you received this in error, please contact the
>> >>>>> sender and delete this email from your system. The contents of
>> >>>>> this e-mail are the views of the sender and do not necessarily
>> >>>>> represent the views of the Babraham Institute. Full conditions at:
>> >>>>>
>> www.babraham.ac.uk<http://www.babraham.ac.uk/email_disclaimer.html
>> >
>  
>
>> -----Original Message-----
>> From: Confocal Microscopy List
>> [mailto:[hidden email]] On Behalf Of George
>> McNamara
>> Sent: Sunday, September 16, 2012 7:21 PM
>> To: [hidden email]
>> Subject: Re: Clover and mRuby2 FPs ... Re: Background fluorescence
>> problem
>>
>> *****
>> To join, leave or search the confocal microscopy listserv, go to:
>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> *****
>>
>>
>>> Hi Roger,
>>>
>>> These are not my FP's!  I read the paper a couple of days ago and
>>> thought it worth mentioning to the listserv.
>>>
>>> The paper states that the plasmids will be available at addgene.org -
>>> presumably (ok, hopefully) in sync with the print edition official
>>> publication date.
>>>
>>> If you are in a hurry, you could contact the PI to try to get the
>>> plasmids early (i.e. offer to provide your fedex number).
>>>
>>> I did not see mRuby in addgene.org either. The original mRuby paper is
>>> PMID:  19194514.
>>>
>>> The mRuby2 DNA sequence is available online at NCBI Nucleotide (search
>>> term: http://www.ncbi.nlm.nih.gov/nuccore?term=eqFP611     )
>>>
>>> Synthetic construct red fluorescent protein Ruby2 gene, partial cds
>>> </nuccore/JX489389.1>
>>>
>>> 711 bp linear other-genetic
>>>
>>> Accession: JX489389.1
>>>    GI: 404332617
>>>
>>> atggtgtcta agggcgaaga gctgatcaag gaaaatatgc gtatgaaggt ggtcatggaa 61
>>> ggttcggtca acggccacca attcaaatgc acaggtgaag gagaaggcaa tccgtacatg 121
>>> ggaactcaaa ccatgaggat caaagtcatc gagggaggac ccctgccatt tgcctttgac 181
>>> attcttgcca cgtcgttcat gtatggcagc cgtactttta tcaagtaccc gaaaggcatt 241
>>> cctgatttct ttaaacagtc ctttcctgag ggttttactt gggaaagagt tacgagatac 301
>>> gaagatggtg gagtcgtcac cgtcatgcag gacaccagcc ttgaggatgg ctgtctcgtt 361
>>> taccacgtcc aagtcagagg ggtaaacttt ccctccaatg gtcccgtgat gcagaagaag 421
>>> accaagggtt gggagcctaa tacagagatg atgtatccag cagatggtgg tctgagggga 481
>>> tacactcata tggcactgaa agttgatggt ggtggccatc tgtcttgctc tttcgtaaca 541
>>> acttacaggt caaaaaagac cgtcgggaac atcaagatgc ccggtatcca tgccgttgat 601
>>> caccgcctgg aaaggttaga ggaaagtgac aatgaaatgt tcgtagtaca acgcgaacac 661
>>> gcagttgcca agttcgccgg gcttggtggt gggatggacg agctgtacaa g
>>>
>>>
>>> I ran the above mRuby2 DNA sequence through one of the free online
>>> codon optimization programs - www.jcat.de   which gave a low CAI score
>>> (CAI 0.27) when I asked for human optimization.
>>>
>>> jcat recommends (CAI 0.96, a typical optimized score):
>>>
>>> ATGGTGAGCAAGGGCGAGGAGCTGATCAAGGAGAACATGCGCATGAAGGT 50
>>> GGTGATGGAGGGCAGCGTGAACGGCCACCAGTTCAAGTGCACCGGCGAGG 100
>>> GCGAGGGCAACCCCTACATGGGCACCCAGACCATGCGCATCAAGGTGATC 150
>>> GAGGGCGGCCCCCTGCCCTTCGCCTTCGACATCCTGGCCACCAGCTTCAT 200
>>> GTACGGCAGCCGCACCTTCATCAAGTACCCCAAGGGCATCCCCGACTTCT 250
>>> TCAAGCAGAGCTTCCCCGAGGGCTTCACCTGGGAGCGCGTGACCCGCTAC 300
>>> GAGGACGGCGGCGTGGTGACCGTGATGCAGGACACCAGCCTGGAGGACGG 350
>>> CTGCCTGGTGTACCACGTGCAGGTGCGCGGCGTGAACTTCCCCAGCAACG 400
>>> GCCCCGTGATGCAGAAGAAGACCAAGGGCTGGGAGCCCAACACCGAGATG 450
>>> ATGTACCCCGCCGACGGCGGCCTGCGCGGCTACACCCACATGGCCCTGAA 500
>>> GGTGGACGGCGGCGGCCACCTGAGCTGCAGCTTCGTGACCACCTACCGCA 550
>>> GCAAGAAGACCGTGGGCAACATCAAGATGCCCGGCATCCACGCCGTGGAC 600
>>> CACCGCCTGGAGCGCCTGGAGGAGAGCGACAACGAGATGTTCGTGGTGCA 650
>>> GCGCGAGCACGCCGTGGCCAAGTTCGCCGGCCTGGGCGGCGGCATGGACG 700
>> AGCTGTACAAG
>>>
>>>
>>> Clover sequence is:
>>>
>>> Synthetic construct *green* *fluorescent* protein Clover gene, partial
>>> cds </nuccore/JX489388.1>
>>>
>>> 684 bp linear other-genetic
>>>
>>> Accession: JX489388.1
>>> GI: 404332615
>>>
>>> their sequence:
>>>
>>> 1 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 61
>>> ggcgacgtaa acggccacaa gttcagcgtc cgcggcgagg gcgagggcga tgccaccaac 121
>>> ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 181
>>> ctcgtgacca ccttcggcta cggcgtggcc tgcttcagcc gctaccccga ccacatgaag 241
>>> cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatctct 301
>>> ttcaaggacg acggtaccta caagacccgc gccgaggtga agttcgaggg cgacaccctg 361
>>> gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 421
>>> aagctggagt acaacttcaa cagccacaac gtctatatca cggccgacaa gcagaagaac 481
>>> ggcatcaagg ctaacttcaa gatccgccac aacgttgagg acggcagcgt gcagctcgcc 541
>>> gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 601
>>> tacctgagcc atcagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 661
>>> ctgctggagt tcgtaaccgc cgcc
>>>
>>> JCat reported a CAI of 0.79 (1.0 being perfect), and recommended: (CAI
>>> 0.956):
>>>
>>> ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGCGTGGTGCCCATCCTGGT 50
>>> GGAGCTGGACGGCGACGTGAACGGCCACAAGTTCAGCGTGCGCGGCGAGG 100
>>> GCGAGGGCGACGCCACCAACGGCAAGCTGACCCTGAAGTTCATCTGCACC 150
>>> ACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTGGTGACCACCTTCGGCTA 200
>>> CGGCGTGGCCTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACT 250
>>> TCTTCAAGAGCGCCATGCCCGAGGGCTACGTGCAGGAGCGCACCATCAGC 300
>>> TTCAAGGACGACGGCACCTACAAGACCCGCGCCGAGGTGAAGTTCGAGGG 350
>>> CGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG 400
>>> ACGGCAACATCCTGGGCCACAAGCTGGAGTACAACTTCAACAGCCACAAC 450
>>> GTGTACATCACCGCCGACAAGCAGAAGAACGGCATCAAGGCCAACTTCAA 500
>>> GATCCGCCACAACGTGGAGGACGGCAGCGTGCAGCTGGCCGACCACTACC 550
>>> AGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCAC 600
>>> TACCTGAGCCACCAGAGCGCCCTGAGCAAGGACCCCAACGAGAAGCGCGA 650
>>> CCACATGGTGCTGCTGGAGTTCGTGACCGCCGCC
>>>
>>>
>>>
>>> at 711 bases - each, you might find it cost effective to simply order
>>> this (or pick your favorite optimizer ... or optimize for your
>>> favorite organism) sequence from some DNA synthesis company.
>>>
>>> If the company charges by the gene, you could stick in a short linker
>>> (see the paper, or use Steven Vogel's sequence in C5V or in between
>>> his V's of V6) and have 711+(say)15+711 base sequence synthesized. If
>>> you posted that plasmid to addgene.org, and mentioned codon optimized
>>> for human (and maybe stuck on a promoter or maximized Gateway
>>> compatibility), would probably lead to being your most popular addgene
>>> construct and (when you publish it) most referenced technical paper.
>>>
>>> Enjoy,
>>>
>>> George
>>>
>>>
>>> On 9/16/2012 12:28 PM, Roger Phillips wrote:
>>>> Dear George,
>>>> Have you looked at lifetime kinetics in the transfer from Clover to
>> mRuby2?  I only have access to the paper copy of Nature Methods so won't
>> read the details till next month. We are about to shift from fixed to
>>live cell
>> imaging and we need to choose labels for [] and [].  Are the vectors for
>> fusion construction and for controls (Clover-mRuby2 tandem construct in
>> sup fig 9 and unfused Clover and mRuby2 available?
>>>> Thanks for your work,
>>>> Roger Phillips
>>>>
>>>> Dr Roger Guy Phillips
>>>> Centre for Advanced Microscopy,
>>>> University of Sussex
>>>> School of Life Sciences
>>>> John Maynard Smith Building
>>>> Falmer, Brighton&  Hove
>>>> BN1 9QG
>>>> United Kingdom
>>>>
>>>> phone:[phone]
>>>> fax: [phone]
>>>> email:[hidden email]
>>>> room:2C9 (ext 7585)/lab 4C2 (ext 2734)
>>>>
>>>>
>>>>
>>>>
>>>> -----Original Message-----
>>>> From: Confocal Microscopy List
>>>> [mailto:[hidden email]] On Behalf Of George
>>>> McNamara
>>>> Sent: 15 September 2012 01:33
>>>> To:[hidden email]
>>>> Subject: Clover and mRuby2 FPs ... Re: Background fluorescence
>>>> problem
>>>>
>>>> *****
>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>> *****
>>>>
>>>> Hi Kurt,
>>>>
>>>> Clover and mruby2 are described in the Lam et al paper at Nature
>>>> Methods
>>>>
>>>>
>> http://www.nature.com/nmeth/journal/vaop/ncurrent/full/nmeth.2171.ht
>> m
>>>> l
>>>>
>>>> A variety of genetically encoded reporters use changes in
>>>> fluorescence (or Förster) resonance energy transfer (FRET) to report
>>>>on
>> biochemical processes in living cells. The standard genetically encoded
>>FRET
>> pair consists of CFPs and YFPs, but many CFP-YFP reporters suffer from
>>low
>> FRET dynamic range, phototoxicity from the CFP excitation light and
>> complex photokinetic events such as reversible photobleaching and
>> photoconversion. We engineered two fluorescent proteins, Clover and
>> mRuby2, which are the brightest green and red fluorescent proteins to
>>date
>> and have the highest Förster radius of any ratiometric FRET pair yet
>> described. Replacement of CFP and YFP with these two proteins in
>>reporters
>> of kinase activity, small GTPase activity and transmembrane voltage
>> significantly improves photostability, FRET dynamic range and emission
>> ratio changes. These improvements enhance detection of transient
>> biochemical events such as neuronal action-potential firing and RhoA act
>> ivation in growth cones.
>>>>
>>>>
>>>>
>>>> On 9/14/2012 2:58 PM, Kurt Thorn wrote:
>>>>
>>>>> *****
>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>> *****
>>>>>
>>>>> What is Clover GFP? I can't find much information about it on Google.
>>>>>
>>>>> Thanks,
>>>>> Kurt
>>>>>
>>>>> On 9/14/2012 3:49 AM, George McNamara wrote:
>>>>>
>>>>>> *****
>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>> *****
>>>>>>
>>>>>> Hi Simon,
>>>>>>
>>>>>> Your cells might not need the 100x excess of riboflavin present in
>>>>>> "standard" DMEM, your background could be reduced. The Essen tech
>>>>>> note I mentioned lists:
>>>>>> DMEM 0.4 mg/L riboflavin ... 43.6 units fluorescence
>>>>>> Eagles MEM 0.1 mg/mL     ... 12.9
>>>>>> F12K            0.04               ... 5.4
>>>>>> EBM             0.004             ... 3.7
>>>>>> Riboflavin (alone) 0.4          ... 58.7 (perhaps suggesting that
>>>>>> culture media quenches riboflavin or it gets converted in part to
>>>>>> something less fluorescent?) Contact Essen if you want the entire
>>>>>> tech note.
>>>>>>
>>>>>>
>>>>>> If you absolutely require a green fluorescent protein, spend the
>>>>>> time to switch to the new Clover or "V6" from Steven Vogel
>>>>>> (available from addgene.org as VVVVVV).
>>>>>> If you do not need green, switch to tdTomato or the new mRuby2.
>>>>>>
>>>>>>
>>>>>>
>>>>>> Create File
>>>>>> Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. [Epub ahead of
>>>>>> print]
>>>>>>
>>>>>>
>>>>>>  Improving FRET dynamic range with bright green and red
>>>>>> fluorescent proteins.
>>>>>>
>>>>>> Lam AJ (et al)
>>>>>>
>>>>>>      Abstract
>>>>>>
>>>>>> A variety of genetically encoded reporters use changes in
>>>>>> fluorescence resonance energy transfer (FRET) to report on
>>>>>> biochemical processes in living cells. The standard genetically
>>>>>> encoded FRET pair consists of CFPs and YFPs, but many CFP-YFP
>>>>>> reporters suffer from low FRET dynamic range, phototoxicity from
>>>>>> the CFP excitation light and complex photokinetic events such as
>>>>>> reversible photobleaching and photoconversion. We engineered two
>>>>>> fluorescent proteins,* Clover and mRuby2*, which are the brightest
>>>>>> green and red fluorescent proteins to date and have the highest
>>>>>> Förster radius of any ratiometric FRET pair yet described.
>>>>>> Replacement of CFP and YFP with these two proteins in reporters of
>>>>>> kinase activity, small GTPase activity and transmembrane voltage
>>>>>> significantly improves photostability, FRET dynamic range and
>>>>>> emission ratio changes. These improvements enhance detection of
>>>>>> transient biochemical events such as neuronal action-potential
>>>>>> firing and RhoA activation in growth cones.
>>>>>>
>>>>>> PMID:
>>>>>>    22961245
>>>>>>
>>>>>>
>>>>>> PLoS One.<#>  2012;7(5):e38209. Epub 2012 May 30.
>>>>>>
>>>>>>
>>>>>>  Fluorescence polarization and fluctuation analysis monitors
>>>>>> subunit proximity, stoichiometry, and protein complex hydrodynamics.
>>>>>>
>>>>>> Nguyen TA ...  Vogel SS
>>>>>>
>>>>>>      Abstract
>>>>>>
>>>>>> Förster resonance energy transfer (FRET) microscopy is frequently
>>>>>> used to study protein interactions and conformational changes in
>>>>>> living cells. The utility of FRET is limited by false positive and
>>>>>> negative signals. To overcome these limitations we have developed
>>>>>> Fluorescence Polarization and Fluctuation Analysis (FPFA), a hybrid
>>>>>> single-molecule based method combining time-resolved fluorescence
>>>>>> anisotropy (homo-FRET) and fluorescence correlation spectroscopy.
>>>>>> Using FPFA, homo-FRET (a 1-10 nm proximity gauge), brightness (a
>>>>>> measure of the number of fluorescent subunits in a complex), and
>>>>>> correlation time (an attribute sensitive to the mass and shape of a
>>>>>> protein complex) can be simultaneously measured. These
>> measurements
>>>>>> together rigorously constrain the interpretation of FRET signals.
>>>>>> Venus based control-constructs were used to validate FPFA. The
>>>>>> utility of FPFA was demonstrated by measuring in living cells the
>>>>>> number of subunits in the ?-isoform of Venus-tagged
>>>>>> calcium-calmodulin dependent protein kinase-II (CaMKII?)
>> holoenzyme.
>>>>>> Brightness analysis revealed that the holoenzyme has, on average,
>>>>>> 11.9 ± 1.2 subunit, but values ranged from 10-14 in individual
>>>>>>cells.
>>>>>> Homo-FRET analysis simultaneously detected that catalytic domains
>>>>>> were arranged as dimers in the dodecameric holoenzyme, and this
>>>>>> paired organization was confirmed by quantitative hetero-FRET
>>>>>> analysis. In freshly prepared cell homogenates FPFA detected only
>>>>>> 10.2 ± 1.3 subunits in the holoenzyme with values ranging from 9-12.
>>>>>> Despite the reduction in subunit number, catalytic domains were
>>>>>> still arranged as pairs in homogenates. Thus, FPFA suggests that
>>>>>> while the absolute number of subunits in an auto-inhibited
>>>>>> holoenzyme might vary from cell to cell, the organization of
>>>>>> catalytic domains into pairs is preserved.
>>>>>>
>>>>>> PMID:
>>>>>>    22666486
>>>>>>
>>>>>>
>>>>>> I am a bit disappointed Vogel's group did not go for V8 (a well
>>>>>> known
>>>>>> drink) or V12 - the latter either as a polypeptide or with
>>>>>> inducible dimerization domain. V12 since the goal of this paper is
>>>>>> to quantify the number of subunits in CaMKIIalpha, which turns out
>>>>>> to be 12 (+/- a few) as described in
>>>>>> http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3364239/figure/pone-
>> 003
>>>>>> 82
>>>>>> 09-g004/
>>>>>>
>>>>>>
>>>>>> On 9/14/2012 4:32 AM, simon walker wrote:
>>>>>>
>>>>>>> *****
>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>>> *****
>>>>>>>
>>>>>>> Thanks for the various responses.  Yes, I'd seen the Bogdanov
>>>>>>> paper and the Evrogen medium and thought that might be worth a
>>>>>>> try.  The problem we have is that for our assay the culture medium
>>>>>>> is absolutely critical (it's not just a case of keeping cells
>>>>>>> alive), so we can't use a minimal HEPES-based buffer.  I am
>>>>>>> interested to know what is in the 'BackDrop' solution.  We can't
>>>>>>> use it unless we're fairly confident it's not going to affect our
>>>>>>>assay.
>>>>>>> Simon
>>>>>>>
>>>>>>>
>>>>>>> -----Original Message-----
>>>>>>> From: Confocal Microscopy List
>>>>>>> [mailto:[hidden email]] On Behalf Of
>> George
>>>>>>> McNamara
>>>>>>> Sent: 14 September 2012 01:57
>>>>>>> To:[hidden email]
>>>>>>> Subject: Re: Background fluorescence problem
>>>>>>>
>>>>>>> *****
>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>>> *****
>>>>>>>
>>>>>>> Hi Simon,
>>>>>>>
>>>>>>> likely riboflavin and possibly other flavins. See
>>>>>>>
>> http://www.evrogen.com/products/medium_DMEM_gfp/medium_DMEM_
>> gfp.sh
>>>>>>> tm l and the Bogdanov et al paper referenced  at the bottom of the
>>>>>>> page;
>>>>>>>
>>>>>>>      * Bogdanov AM, Bogdanova EA, Chudakov DM, Gorodnicheva TV,
>>>>>>> Lukyanov
>>>>>>>        S, Lukyanov KA. Cell culture medium affects GFP
>>>>>>> photostability: a
>>>>>>>        solution. Nat Methods. 2009; 6 (12):859-60. / pmid:
>>>>>>> 19935837
>>>>>>>
>> <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Pub
>>>>>>> Me d&list_uids=19935837&dopt=Abstract>
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>> Their solution: incubate cells in miedia without (or with low, if
>>>>>>> needed) riboflavin for a day.
>>>>>>>
>>>>>>> As a bonus, riboflavin quenches (FRET?) and/or transiently
>>>>>>> photoconverts GFP to red fluorescence (might be mostly dark
>>>>>>>states):
>>>>>>>
>>>>>>> Condensed mitotic chromosome structure at nanometer resolution
>>>>>>> using PALM and EGFP- histones.</pubmed/20856676>* Matsuda* A,
>> Shao
>>>>>>> L, Boulanger J, Kervrann C, Carlton PM, Kner P, Agard D, *Sedat*
>>>>>>>JW.
>>>>>>> PLoS One. 2010 Sep 15;5(9):e12768. PMID: 20856676
>>>>>>>
>>>>>>>
>>>>>>> If you contact Essen Biosciences, they will (hopefully) give you a
>>>>>>> copy of their application note on the concentrations of riboflavin
>>>>>>> in many culture media and correlation with fluorescence of those
>>>>>>> media. Speaking of Essen - they finally introduced a dual
>>>>>>> green+red fluorescence Incucyte.
>>>>>>>
>>>>>>> Enjoy,
>>>>>>>
>>>>>>> George
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>> On 9/13/2012 11:04 AM, Simon Walker wrote:
>>>>>>>
>>>>>>>> *****
>>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>>>> *****
>>>>>>>>
>>>>>>>> Dear List,
>>>>>>>> We are imaging very weakly fluorescent live cells (expressing
>>>>>>>> GFP) on a wide- field system and having issues with a source of
>>>>>>>> background fluorescence.
>>>>>>>> When we look at our cells under epi-illumination we see a rapid
>>>>>>>> drop in a weak background signal (not where the cells are) that
>>>>>>>> fully recovers over a ~10 s period after the illumination light
>>>>>>>> is switched off.  Our experiments require the use of DMEM as the
>>>>>>>> imaging medium and this is the likely cause of problem.  It
>>>>>>>> appears that something in the medium is sticking to the
>>>>>>>> coverglass.  It's not phenol red as the effect is seen with both
>>>>>>>> phenol red-containing and phenol- red-free DMEM.  Does anyone
>>>>>>>> know what else it could be?  Has anyone else seen anything
>>>>>>>> similar?  We're wondering if it could be riboflavin which is in
>>>>>>>>the
>> DMEM we're using.  Would this stick to glass?
>>>>>>>>
>>>>>>>> I've seen that Life Technologies now market a substance that
>>>>>>>> allegedly surpresses background fluorescence in DMEM:
>>>>>>>> http://products.invitrogen.com/ivgn/product/R37603
>>>>>>>> Has anyone tried this?  Does anyone know how it works?
>>>>>>>>
>>>>>>>> Thanks,
>>>>>>>> Simon
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>> The Babraham Institute, Babraham Research Campus, Cambridge CB22
>>>>>>> 3AT Registered Charity No. 1053902.
>>>>>>> The information transmitted in this email is directed only to the
>>>>>>> addressee. If you received this in error, please contact the
>>>>>>> sender and delete this email from your system. The contents of
>>>>>>> this e-mail are the views of the sender and do not necessarily
>>>>>>> represent the views of the Babraham Institute. Full conditions at:
>>>>>>>
>> www.babraham.ac.uk<http://www.babraham.ac.uk/email_disclaimer.html
>>>
>

[Tobias Rose]

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

Interesting!

I think I'll leave the established sequences as they are. Well: maybe I'll get rid of one or two restriction sites. mRuby2 is a different question, though - I did not make up my mind yet…

I optimized the tdtomato and Gcamp sequences before - it's just extremely tough to judge whether that did any good or not in my case.

Tobias

PS: I apologise for attributing the Lam et al. mRuby2 / Clover paper incorrectly: Last author is Michael Lin.

On Oct 17, 2012, at 1:16 PM, "Dolphin, Colin" <[hidden email]> wrote:

> *****
> To join, leave or search the confocal microscopy listserv, go to:
> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
> *****
>
> We spent sometime designing codon-optimized FPs for expression in C.
> elegans and found, in two out of three cases, that in otherwise equivalent
> transgenic animals, codon-optimized FP expression was severely compromised
> in comparison to the 'established' coding sequences that had been, and
> still are, used in worms since their initial development as reporters. As
> well as being different with respect to codon use our 'codon-optimized'
> sequences had two, unequally spaced artificial introns whereas the
> otherwise equivalent but non 'codon-optimized' coding sequences all had
> three equally spaced introns. We might just have been unlucky but I think
> there are other variables - such as use, number and placement of introns -
> that may as important, if not more so. 'Codon-optimization' may not be the
> only thing to consider and, as such, in some situations it may be a case
> of 'if it aint broke don't fix it'!
>
>
>
> Colin
>
> On 17/10/2012 10:54, "Tobias Rose" <[hidden email]> wrote:
>
>> *****
>> To join, leave or search the confocal microscopy listserv, go to:
>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> *****
>>
>> Hi everybody,
>>
>> Sorry to warm up this old thread and please excuse the lengthy post - but
>> I am about to do precisely what George suggested: Synthesize mRuby2.
>> (well: without the publish to addgene and try to snatch citations away
>> from R. Tsien bit...). And by the way: All plasmids from that publication
>> are available on addgene now: http://www.addgene.org/browse/article/5906/
>> .
>> Be aware that there are quite a few tags on the N-terminus of mRuby2...
>>
>> The question that I am asking myself for a while now is:
>> Is codon optimization really worth it?
>>
>> Due to lack of time and to increase turnover I am by now synthesizing
>> most of my DNA. With the breakneck speed that fluorescent proteins and
>> genetically encoded functional indicators are developed right now it's
>> almost impossible to keep up without synthesis. And it¹s also very
>> convenient...
>>
>> However: besides all the PR talk of synthesis companies I don't really
>> know if codon optimization (for mouse in my case) would do more harm than
>> good. For instance, next to all the semi-anecdotal optimization papers
>> out there there is still this Science paper here:
>>
>> Coding-Sequence Determinants of Gene Expression in Escherichia coli
>> Grzegorz Kudla, Andrew W. Murray, David Tollervey, and Joshua B. Plotkin
>> Science 10 April 2009: 324 (5924), 255-258. [DOI:10.1126/science.1170160]
>>
>> At least in e. coli codon usage appears to not matter at all (see also
>> discussion here:
>> http://omicsomics.blogspot.de/2009/04/is-codon-optimization-bunk.html ).
>>
>> Also, even though I cannot judge it, it's stated in my 'AAV cookbook':
>> "[...It should be noted, however, that the potential for introduction of
>> sequences that negatively affect gene expression is also a risk with this
>> process, and it is difficult to predict which sequences will have such an
>> effect. For example, it has been shown that the sequences coding for
>> protein domain boundaries are more likely to be coded by ³translationally
>> slow² codons [...]"
>> Gray, J. T. & Zolotukhin, S. Adeno-Associated Virus. 807, 25­46 (2011).
>>
>> Right now I don't even know if the run of the mill XFPs available from
>> addgene or Tsien himself _are_ in any way codon-optimized away from the
>> original species towards mammalian use.
>>
>> Whould you say that it makes sense, for example, to further 'optimize'
>> very established sequences like standard XFPs (in my case for tdtomato
>> and GCaMPx (genetically-encoded Ca2+ indicator [GFP + calmodulin +
>> M13peptide])?  The problem with the CAI score that George posted (next to
>> the fact that that's only one out of many ways to codon optimize) is that
>> I'm getting entirely different CAI scores from different calculators and
>> especially also for different mammalian species  (e.g. human vs. mouse -
>> is codon usage really that different here?):
>>
>> Example:
>> mRUBY2 CDS
>>
>> www.jcat.de
>> human
>> before opt:
>> CAI 0.27
>>
>> After opt:
>> CAI 0.95
>>
>> Mouse (my target):
>> before opt
>> CAI 0.23
>>
>> after opt:
>> CAI 0.72
>>
>> Same sequence with genscript:
>> http://www.genscript.com/cgi-bin/tools/rare_codon_analysis
>>
>> human
>> before opt
>> CAI : 0.75
>>
>> Mouse
>> before opt
>> CAI : 0.75
>>
>> As usual, optimisation is proprietary hereŠ and might be biased towards
>> ease of synthesis and not necessary towards best possible expression.
>>
>> And then there is the entirely different optimization from other
>> companies like DNA2.0...
>>
>> What is your opinion: voodoo or not? Would you change 'established'
>> sequences to increase expression - or would you just optimize when you
>> switch species?
>>
>> Thanks,T
>>
>> Also: What's your bet - is mRuby2 the best red/orange protein ever -- or
>> would you still use mCherry or (td)tomato in spite of all the
>> cytotoxicity rumours?
>>
>>
>>
>>
>>
>>
>>> -----Original Message-----
>>> From: Confocal Microscopy List
>>> [mailto:[hidden email]] On Behalf Of George
>>> McNamara
>>> Sent: Sunday, September 16, 2012 7:21 PM
>>> To: [hidden email]
>>> Subject: Re: Clover and mRuby2 FPs ... Re: Background fluorescence
>>> problem
>>>
>>> *****
>>> To join, leave or search the confocal microscopy listserv, go to:
>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>> *****
>>>
>>>
>>>> Hi Roger,
>>>>
>>>> These are not my FP's!  I read the paper a couple of days ago and
>>>> thought it worth mentioning to the listserv.
>>>>
>>>> The paper states that the plasmids will be available at addgene.org -
>>>> presumably (ok, hopefully) in sync with the print edition official
>>>> publication date.
>>>>
>>>> If you are in a hurry, you could contact the PI to try to get the
>>>> plasmids early (i.e. offer to provide your fedex number).
>>>>
>>>> I did not see mRuby in addgene.org either. The original mRuby paper is
>>>> PMID:  19194514.
>>>>
>>>> The mRuby2 DNA sequence is available online at NCBI Nucleotide (search
>>>> term: http://www.ncbi.nlm.nih.gov/nuccore?term=eqFP611      )
>>>>
>>>> Synthetic construct red fluorescent protein Ruby2 gene, partial cds
>>>> </nuccore/JX489389.1>
>>>>
>>>> 711 bp linear other-genetic
>>>>
>>>> Accession: JX489389.1
>>>>    GI: 404332617
>>>>
>>>> atggtgtcta agggcgaaga gctgatcaag gaaaatatgc gtatgaaggt ggtcatggaa 61
>>>> ggttcggtca acggccacca attcaaatgc acaggtgaag gagaaggcaa tccgtacatg 121
>>>> ggaactcaaa ccatgaggat caaagtcatc gagggaggac ccctgccatt tgcctttgac 181
>>>> attcttgcca cgtcgttcat gtatggcagc cgtactttta tcaagtaccc gaaaggcatt 241
>>>> cctgatttct ttaaacagtc ctttcctgag ggttttactt gggaaagagt tacgagatac 301
>>>> gaagatggtg gagtcgtcac cgtcatgcag gacaccagcc ttgaggatgg ctgtctcgtt 361
>>>> taccacgtcc aagtcagagg ggtaaacttt ccctccaatg gtcccgtgat gcagaagaag 421
>>>> accaagggtt gggagcctaa tacagagatg atgtatccag cagatggtgg tctgagggga 481
>>>> tacactcata tggcactgaa agttgatggt ggtggccatc tgtcttgctc tttcgtaaca 541
>>>> acttacaggt caaaaaagac cgtcgggaac atcaagatgc ccggtatcca tgccgttgat 601
>>>> caccgcctgg aaaggttaga ggaaagtgac aatgaaatgt tcgtagtaca acgcgaacac 661
>>>> gcagttgcca agttcgccgg gcttggtggt gggatggacg agctgtacaa g
>>>>
>>>>
>>>> I ran the above mRuby2 DNA sequence through one of the free online
>>>> codon optimization programs - www.jcat.de   which gave a low CAI score
>>>> (CAI 0.27) when I asked for human optimization.
>>>>
>>>> jcat recommends (CAI 0.96, a typical optimized score):
>>>>
>>>> ATGGTGAGCAAGGGCGAGGAGCTGATCAAGGAGAACATGCGCATGAAGGT 50
>>>> GGTGATGGAGGGCAGCGTGAACGGCCACCAGTTCAAGTGCACCGGCGAGG 100
>>>> GCGAGGGCAACCCCTACATGGGCACCCAGACCATGCGCATCAAGGTGATC 150
>>>> GAGGGCGGCCCCCTGCCCTTCGCCTTCGACATCCTGGCCACCAGCTTCAT 200
>>>> GTACGGCAGCCGCACCTTCATCAAGTACCCCAAGGGCATCCCCGACTTCT 250
>>>> TCAAGCAGAGCTTCCCCGAGGGCTTCACCTGGGAGCGCGTGACCCGCTAC 300
>>>> GAGGACGGCGGCGTGGTGACCGTGATGCAGGACACCAGCCTGGAGGACGG 350
>>>> CTGCCTGGTGTACCACGTGCAGGTGCGCGGCGTGAACTTCCCCAGCAACG 400
>>>> GCCCCGTGATGCAGAAGAAGACCAAGGGCTGGGAGCCCAACACCGAGATG 450
>>>> ATGTACCCCGCCGACGGCGGCCTGCGCGGCTACACCCACATGGCCCTGAA 500
>>>> GGTGGACGGCGGCGGCCACCTGAGCTGCAGCTTCGTGACCACCTACCGCA 550
>>>> GCAAGAAGACCGTGGGCAACATCAAGATGCCCGGCATCCACGCCGTGGAC 600
>>>> CACCGCCTGGAGCGCCTGGAGGAGAGCGACAACGAGATGTTCGTGGTGCA 650
>>>> GCGCGAGCACGCCGTGGCCAAGTTCGCCGGCCTGGGCGGCGGCATGGACG 700
>>> AGCTGTACAAG
>>>>
>>>>
>>>> Clover sequence is:
>>>>
>>>> Synthetic construct *green* *fluorescent* protein Clover gene, partial
>>>> cds </nuccore/JX489388.1>
>>>>
>>>> 684 bp linear other-genetic
>>>>
>>>> Accession: JX489388.1
>>>> GI: 404332615
>>>>
>>>> their sequence:
>>>>
>>>> 1 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 61
>>>> ggcgacgtaa acggccacaa gttcagcgtc cgcggcgagg gcgagggcga tgccaccaac 121
>>>> ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 181
>>>> ctcgtgacca ccttcggcta cggcgtggcc tgcttcagcc gctaccccga ccacatgaag 241
>>>> cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatctct 301
>>>> ttcaaggacg acggtaccta caagacccgc gccgaggtga agttcgaggg cgacaccctg 361
>>>> gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 421
>>>> aagctggagt acaacttcaa cagccacaac gtctatatca cggccgacaa gcagaagaac 481
>>>> ggcatcaagg ctaacttcaa gatccgccac aacgttgagg acggcagcgt gcagctcgcc 541
>>>> gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 601
>>>> tacctgagcc atcagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 661
>>>> ctgctggagt tcgtaaccgc cgcc
>>>>
>>>> JCat reported a CAI of 0.79 (1.0 being perfect), and recommended: (CAI
>>>> 0.956):
>>>>
>>>> ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGCGTGGTGCCCATCCTGGT 50
>>>> GGAGCTGGACGGCGACGTGAACGGCCACAAGTTCAGCGTGCGCGGCGAGG 100
>>>> GCGAGGGCGACGCCACCAACGGCAAGCTGACCCTGAAGTTCATCTGCACC 150
>>>> ACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTGGTGACCACCTTCGGCTA 200
>>>> CGGCGTGGCCTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACT 250
>>>> TCTTCAAGAGCGCCATGCCCGAGGGCTACGTGCAGGAGCGCACCATCAGC 300
>>>> TTCAAGGACGACGGCACCTACAAGACCCGCGCCGAGGTGAAGTTCGAGGG 350
>>>> CGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG 400
>>>> ACGGCAACATCCTGGGCCACAAGCTGGAGTACAACTTCAACAGCCACAAC 450
>>>> GTGTACATCACCGCCGACAAGCAGAAGAACGGCATCAAGGCCAACTTCAA 500
>>>> GATCCGCCACAACGTGGAGGACGGCAGCGTGCAGCTGGCCGACCACTACC 550
>>>> AGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCAC 600
>>>> TACCTGAGCCACCAGAGCGCCCTGAGCAAGGACCCCAACGAGAAGCGCGA 650
>>>> CCACATGGTGCTGCTGGAGTTCGTGACCGCCGCC
>>>>
>>>>
>>>>
>>>> at 711 bases - each, you might find it cost effective to simply order
>>>> this (or pick your favorite optimizer ... or optimize for your
>>>> favorite organism) sequence from some DNA synthesis company.
>>>>
>>>> If the company charges by the gene, you could stick in a short linker
>>>> (see the paper, or use Steven Vogel's sequence in C5V or in between
>>>> his V's of V6) and have 711+(say)15+711 base sequence synthesized. If
>>>> you posted that plasmid to addgene.org, and mentioned codon optimized
>>>> for human (and maybe stuck on a promoter or maximized Gateway
>>>> compatibility), would probably lead to being your most popular addgene
>>>> construct and (when you publish it) most referenced technical paper.
>>>>
>>>> Enjoy,
>>>>
>>>> George
>>>>
>>>>
>>>> On 9/16/2012 12:28 PM, Roger Phillips wrote:
>>>>> Dear George,
>>>>> Have you looked at lifetime kinetics in the transfer from Clover to
>>> mRuby2?  I only have access to the paper copy of Nature Methods so won't
>>> read the details till next month. We are about to shift from fixed to
>>> live cell
>>> imaging and we need to choose labels for [] and [].  Are the vectors for
>>> fusion construction and for controls (Clover-mRuby2 tandem construct in
>>> sup fig 9 and unfused Clover and mRuby2 available?
>>>>> Thanks for your work,
>>>>> Roger Phillips
>>>>>
>>>>> Dr Roger Guy Phillips
>>>>> Centre for Advanced Microscopy,
>>>>> University of Sussex
>>>>> School of Life Sciences
>>>>> John Maynard Smith Building
>>>>> Falmer, Brighton&  Hove
>>>>> BN1 9QG
>>>>> United Kingdom
>>>>>
>>>>> phone:[phone]
>>>>> fax: [phone]
>>>>> email:[hidden email]
>>>>> room:2C9 (ext 7585)/lab 4C2 (ext 2734)
>>>>>
>>>>>
>>>>>
>>>>>
>>>>> -----Original Message-----
>>>>> From: Confocal Microscopy List
>>>>> [mailto:[hidden email]] On Behalf Of George
>>>>> McNamara
>>>>> Sent: 15 September 2012 01:33
>>>>> To:[hidden email]
>>>>> Subject: Clover and mRuby2 FPs ... Re: Background fluorescence
>>>>> problem
>>>>>
>>>>> *****
>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>> *****
>>>>>
>>>>> Hi Kurt,
>>>>>
>>>>> Clover and mruby2 are described in the Lam et al paper at Nature
>>>>> Methods
>>>>>
>>>>>
>>> http://www.nature.com/nmeth/journal/vaop/ncurrent/full/nmeth.2171.ht
>>> m
>>>>> l
>>>>>
>>>>> A variety of genetically encoded reporters use changes in
>>>>> fluorescence (or Förster) resonance energy transfer (FRET) to report
>>> on
>>> biochemical processes in living cells. The standard genetically encoded
>>> FRET
>>> pair consists of CFPs and YFPs, but many CFP-YFP reporters suffer from
>>> low
>>> FRET dynamic range, phototoxicity from the CFP excitation light and
>>> complex photokinetic events such as reversible photobleaching and
>>> photoconversion. We engineered two fluorescent proteins, Clover and
>>> mRuby2, which are the brightest green and red fluorescent proteins to
>>> date
>>> and have the highest Förster radius of any ratiometric FRET pair yet
>>> described. Replacement of CFP and YFP with these two proteins in
>>> reporters
>>> of kinase activity, small GTPase activity and transmembrane voltage
>>> significantly improves photostability, FRET dynamic range and emission
>>> ratio changes. These improvements enhance detection of transient
>>> biochemical events such as neuronal action-potential firing and RhoA act
>>> ivation in growth cones.
>>>>>
>>>>>
>>>>>
>>>>> On 9/14/2012 2:58 PM, Kurt Thorn wrote:
>>>>>
>>>>>> *****
>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>> *****
>>>>>>
>>>>>> What is Clover GFP? I can't find much information about it on
>>> Google.
>>>>>>
>>>>>> Thanks,
>>>>>> Kurt
>>>>>>
>>>>>> On 9/14/2012 3:49 AM, George McNamara wrote:
>>>>>>
>>>>>>> *****
>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>>> *****
>>>>>>>
>>>>>>> Hi Simon,
>>>>>>>
>>>>>>> Your cells might not need the 100x excess of riboflavin present in
>>>>>>> "standard" DMEM, your background could be reduced. The Essen tech
>>>>>>> note I mentioned lists:
>>>>>>> DMEM 0.4 mg/L riboflavin ... 43.6 units fluorescence
>>>>>>> Eagles MEM 0.1 mg/mL     ... 12.9
>>>>>>> F12K            0.04               ... 5.4
>>>>>>> EBM             0.004             ... 3.7
>>>>>>> Riboflavin (alone) 0.4          ... 58.7 (perhaps suggesting that
>>>>>>> culture media quenches riboflavin or it gets converted in part to
>>>>>>> something less fluorescent?) Contact Essen if you want the entire
>>>>>>> tech note.
>>>>>>>
>>>>>>>
>>>>>>> If you absolutely require a green fluorescent protein, spend the
>>>>>>> time to switch to the new Clover or "V6" from Steven Vogel
>>>>>>> (available from addgene.org as VVVVVV).
>>>>>>> If you do not need green, switch to tdTomato or the new mRuby2.
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>> Create File
>>>>>>> Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. [Epub ahead of
>>>>>>> print]
>>>>>>>
>>>>>>>
>>>>>>>  Improving FRET dynamic range with bright green and red
>>>>>>> fluorescent proteins.
>>>>>>>
>>>>>>> Lam AJ (et al)
>>>>>>>
>>>>>>>      Abstract
>>>>>>>
>>>>>>> A variety of genetically encoded reporters use changes in
>>>>>>> fluorescence resonance energy transfer (FRET) to report on
>>>>>>> biochemical processes in living cells. The standard genetically
>>>>>>> encoded FRET pair consists of CFPs and YFPs, but many CFP-YFP
>>>>>>> reporters suffer from low FRET dynamic range, phototoxicity from
>>>>>>> the CFP excitation light and complex photokinetic events such as
>>>>>>> reversible photobleaching and photoconversion. We engineered two
>>>>>>> fluorescent proteins,* Clover and mRuby2*, which are the brightest
>>>>>>> green and red fluorescent proteins to date and have the highest
>>>>>>> Förster radius of any ratiometric FRET pair yet described.
>>>>>>> Replacement of CFP and YFP with these two proteins in reporters of
>>>>>>> kinase activity, small GTPase activity and transmembrane voltage
>>>>>>> significantly improves photostability, FRET dynamic range and
>>>>>>> emission ratio changes. These improvements enhance detection of
>>>>>>> transient biochemical events such as neuronal action-potential
>>>>>>> firing and RhoA activation in growth cones.
>>>>>>>
>>>>>>> PMID:
>>>>>>>    22961245
>>>>>>>
>>>>>>>
>>>>>>> PLoS One.<#>  2012;7(5):e38209. Epub 2012 May 30.
>>>>>>>
>>>>>>>
>>>>>>>  Fluorescence polarization and fluctuation analysis monitors
>>>>>>> subunit proximity, stoichiometry, and protein complex
>>> hydrodynamics.
>>>>>>>
>>>>>>> Nguyen TA ...  Vogel SS
>>>>>>>
>>>>>>>      Abstract
>>>>>>>
>>>>>>> Förster resonance energy transfer (FRET) microscopy is frequently
>>>>>>> used to study protein interactions and conformational changes in
>>>>>>> living cells. The utility of FRET is limited by false positive and
>>>>>>> negative signals. To overcome these limitations we have developed
>>>>>>> Fluorescence Polarization and Fluctuation Analysis (FPFA), a hybrid
>>>>>>> single-molecule based method combining time-resolved fluorescence
>>>>>>> anisotropy (homo-FRET) and fluorescence correlation spectroscopy.
>>>>>>> Using FPFA, homo-FRET (a 1-10 nm proximity gauge), brightness (a
>>>>>>> measure of the number of fluorescent subunits in a complex), and
>>>>>>> correlation time (an attribute sensitive to the mass and shape of a
>>>>>>> protein complex) can be simultaneously measured. These
>>> measurements
>>>>>>> together rigorously constrain the interpretation of FRET signals.
>>>>>>> Venus based control-constructs were used to validate FPFA. The
>>>>>>> utility of FPFA was demonstrated by measuring in living cells the
>>>>>>> number of subunits in the ?-isoform of Venus-tagged
>>>>>>> calcium-calmodulin dependent protein kinase-II (CaMKII?)
>>> holoenzyme.
>>>>>>> Brightness analysis revealed that the holoenzyme has, on average,
>>>>>>> 11.9 ± 1.2 subunit, but values ranged from 10-14 in individual
>>> cells.
>>>>>>> Homo-FRET analysis simultaneously detected that catalytic domains
>>>>>>> were arranged as dimers in the dodecameric holoenzyme, and this
>>>>>>> paired organization was confirmed by quantitative hetero-FRET
>>>>>>> analysis. In freshly prepared cell homogenates FPFA detected only
>>>>>>> 10.2 ± 1.3 subunits in the holoenzyme with values ranging from
>>> 9-12.
>>>>>>> Despite the reduction in subunit number, catalytic domains were
>>>>>>> still arranged as pairs in homogenates. Thus, FPFA suggests that
>>>>>>> while the absolute number of subunits in an auto-inhibited
>>>>>>> holoenzyme might vary from cell to cell, the organization of
>>>>>>> catalytic domains into pairs is preserved.
>>>>>>>
>>>>>>> PMID:
>>>>>>>    22666486
>>>>>>>
>>>>>>>
>>>>>>> I am a bit disappointed Vogel's group did not go for V8 (a well
>>>>>>> known
>>>>>>> drink) or V12 - the latter either as a polypeptide or with
>>>>>>> inducible dimerization domain. V12 since the goal of this paper is
>>>>>>> to quantify the number of subunits in CaMKIIalpha, which turns out
>>>>>>> to be 12 (+/- a few) as described in
>>>>>>> http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3364239/figure/pone-
>>> 003
>>>>>>> 82
>>>>>>> 09-g004/
>>>>>>>
>>>>>>>
>>>>>>> On 9/14/2012 4:32 AM, simon walker wrote:
>>>>>>>
>>>>>>>> *****
>>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>>>> *****
>>>>>>>>
>>>>>>>> Thanks for the various responses.  Yes, I'd seen the Bogdanov
>>>>>>>> paper and the Evrogen medium and thought that might be worth a
>>>>>>>> try.  The problem we have is that for our assay the culture medium
>>>>>>>> is absolutely critical (it's not just a case of keeping cells
>>>>>>>> alive), so we can't use a minimal HEPES-based buffer.  I am
>>>>>>>> interested to know what is in the 'BackDrop' solution.  We can't
>>>>>>>> use it unless we're fairly confident it's not going to affect our
>>> assay.
>>>>>>>> Simon
>>>>>>>>
>>>>>>>>
>>>>>>>> -----Original Message-----
>>>>>>>> From: Confocal Microscopy List
>>>>>>>> [mailto:[hidden email]] On Behalf Of
>>> George
>>>>>>>> McNamara
>>>>>>>> Sent: 14 September 2012 01:57
>>>>>>>> To:[hidden email]
>>>>>>>> Subject: Re: Background fluorescence problem
>>>>>>>>
>>>>>>>> *****
>>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>>>> *****
>>>>>>>>
>>>>>>>> Hi Simon,
>>>>>>>>
>>>>>>>> likely riboflavin and possibly other flavins. See
>>>>>>>>
>>> http://www.evrogen.com/products/medium_DMEM_gfp/medium_DMEM_
>>> gfp.sh
>>>>>>>> tm l and the Bogdanov et al paper referenced  at the bottom of the
>>>>>>>> page;
>>>>>>>>
>>>>>>>>      * Bogdanov AM, Bogdanova EA, Chudakov DM, Gorodnicheva TV,
>>>>>>>> Lukyanov
>>>>>>>>        S, Lukyanov KA. Cell culture medium affects GFP
>>>>>>>> photostability: a
>>>>>>>>        solution. Nat Methods. 2009; 6 (12):859-60. / pmid:
>>>>>>>> 19935837
>>>>>>>>
>>> <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Pub
>>>>>>>> Me d&list_uids=19935837&dopt=Abstract>
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>> Their solution: incubate cells in miedia without (or with low, if
>>>>>>>> needed) riboflavin for a day.
>>>>>>>>
>>>>>>>> As a bonus, riboflavin quenches (FRET?) and/or transiently
>>>>>>>> photoconverts GFP to red fluorescence (might be mostly dark
>>> states):
>>>>>>>>
>>>>>>>> Condensed mitotic chromosome structure at nanometer resolution
>>>>>>>> using PALM and EGFP- histones.</pubmed/20856676>* Matsuda* A,
>>> Shao
>>>>>>>> L, Boulanger J, Kervrann C, Carlton PM, Kner P, Agard D, *Sedat*
>>> JW.
>>>>>>>> PLoS One. 2010 Sep 15;5(9):e12768. PMID: 20856676
>>>>>>>>
>>>>>>>>
>>>>>>>> If you contact Essen Biosciences, they will (hopefully) give you a
>>>>>>>> copy of their application note on the concentrations of riboflavin
>>>>>>>> in many culture media and correlation with fluorescence of those
>>>>>>>> media. Speaking of Essen - they finally introduced a dual
>>>>>>>> green+red fluorescence Incucyte.
>>>>>>>>
>>>>>>>> Enjoy,
>>>>>>>>
>>>>>>>> George
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>> On 9/13/2012 11:04 AM, Simon Walker wrote:
>>>>>>>>
>>>>>>>>> *****
>>>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>>>>> *****
>>>>>>>>>
>>>>>>>>> Dear List,
>>>>>>>>> We are imaging very weakly fluorescent live cells (expressing
>>>>>>>>> GFP) on a wide- field system and having issues with a source of
>>>>>>>>> background fluorescence.
>>>>>>>>> When we look at our cells under epi-illumination we see a rapid
>>>>>>>>> drop in a weak background signal (not where the cells are) that
>>>>>>>>> fully recovers over a ~10 s period after the illumination light
>>>>>>>>> is switched off.  Our experiments require the use of DMEM as the
>>>>>>>>> imaging medium and this is the likely cause of problem.  It
>>>>>>>>> appears that something in the medium is sticking to the
>>>>>>>>> coverglass.  It's not phenol red as the effect is seen with both
>>>>>>>>> phenol red-containing and phenol- red-free DMEM.  Does anyone
>>>>>>>>> know what else it could be?  Has anyone else seen anything
>>>>>>>>> similar?  We're wondering if it could be riboflavin which is in
>>> the
>>> DMEM we're using.  Would this stick to glass?
>>>>>>>>>
>>>>>>>>> I've seen that Life Technologies now market a substance that
>>>>>>>>> allegedly surpresses background fluorescence in DMEM:
>>>>>>>>> http://products.invitrogen.com/ivgn/product/R37603
>>>>>>>>> Has anyone tried this?  Does anyone know how it works?
>>>>>>>>>
>>>>>>>>> Thanks,
>>>>>>>>> Simon
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>> The Babraham Institute, Babraham Research Campus, Cambridge CB22
>>>>>>>> 3AT Registered Charity No. 1053902.
>>>>>>>> The information transmitted in this email is directed only to the
>>>>>>>> addressee. If you received this in error, please contact the
>>>>>>>> sender and delete this email from your system. The contents of
>>>>>>>> this e-mail are the views of the sender and do not necessarily
>>>>>>>> represent the views of the Babraham Institute. Full conditions at:
>>>>>>>>
>>> www.babraham.ac.uk<http://www.babraham.ac.uk/email_disclaimer.html
>>>>
>>
>>
>>> -----Original Message-----
>>> From: Confocal Microscopy List
>>> [mailto:[hidden email]] On Behalf Of George
>>> McNamara
>>> Sent: Sunday, September 16, 2012 7:21 PM
>>> To: [hidden email]
>>> Subject: Re: Clover and mRuby2 FPs ... Re: Background fluorescence
>>> problem
>>>
>>> *****
>>> To join, leave or search the confocal microscopy listserv, go to:
>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>> *****
>>>
>>>
>>>> Hi Roger,
>>>>
>>>> These are not my FP's!  I read the paper a couple of days ago and
>>>> thought it worth mentioning to the listserv.
>>>>
>>>> The paper states that the plasmids will be available at addgene.org -
>>>> presumably (ok, hopefully) in sync with the print edition official
>>>> publication date.
>>>>
>>>> If you are in a hurry, you could contact the PI to try to get the
>>>> plasmids early (i.e. offer to provide your fedex number).
>>>>
>>>> I did not see mRuby in addgene.org either. The original mRuby paper is
>>>> PMID:  19194514.
>>>>
>>>> The mRuby2 DNA sequence is available online at NCBI Nucleotide (search
>>>> term: http://www.ncbi.nlm.nih.gov/nuccore?term=eqFP611     )
>>>>
>>>> Synthetic construct red fluorescent protein Ruby2 gene, partial cds
>>>> </nuccore/JX489389.1>
>>>>
>>>> 711 bp linear other-genetic
>>>>
>>>> Accession: JX489389.1
>>>>   GI: 404332617
>>>>
>>>> atggtgtcta agggcgaaga gctgatcaag gaaaatatgc gtatgaaggt ggtcatggaa 61
>>>> ggttcggtca acggccacca attcaaatgc acaggtgaag gagaaggcaa tccgtacatg 121
>>>> ggaactcaaa ccatgaggat caaagtcatc gagggaggac ccctgccatt tgcctttgac 181
>>>> attcttgcca cgtcgttcat gtatggcagc cgtactttta tcaagtaccc gaaaggcatt 241
>>>> cctgatttct ttaaacagtc ctttcctgag ggttttactt gggaaagagt tacgagatac 301
>>>> gaagatggtg gagtcgtcac cgtcatgcag gacaccagcc ttgaggatgg ctgtctcgtt 361
>>>> taccacgtcc aagtcagagg ggtaaacttt ccctccaatg gtcccgtgat gcagaagaag 421
>>>> accaagggtt gggagcctaa tacagagatg atgtatccag cagatggtgg tctgagggga 481
>>>> tacactcata tggcactgaa agttgatggt ggtggccatc tgtcttgctc tttcgtaaca 541
>>>> acttacaggt caaaaaagac cgtcgggaac atcaagatgc ccggtatcca tgccgttgat 601
>>>> caccgcctgg aaaggttaga ggaaagtgac aatgaaatgt tcgtagtaca acgcgaacac 661
>>>> gcagttgcca agttcgccgg gcttggtggt gggatggacg agctgtacaa g
>>>>
>>>>
>>>> I ran the above mRuby2 DNA sequence through one of the free online
>>>> codon optimization programs - www.jcat.de   which gave a low CAI score
>>>> (CAI 0.27) when I asked for human optimization.
>>>>
>>>> jcat recommends (CAI 0.96, a typical optimized score):
>>>>
>>>> ATGGTGAGCAAGGGCGAGGAGCTGATCAAGGAGAACATGCGCATGAAGGT 50
>>>> GGTGATGGAGGGCAGCGTGAACGGCCACCAGTTCAAGTGCACCGGCGAGG 100
>>>> GCGAGGGCAACCCCTACATGGGCACCCAGACCATGCGCATCAAGGTGATC 150
>>>> GAGGGCGGCCCCCTGCCCTTCGCCTTCGACATCCTGGCCACCAGCTTCAT 200
>>>> GTACGGCAGCCGCACCTTCATCAAGTACCCCAAGGGCATCCCCGACTTCT 250
>>>> TCAAGCAGAGCTTCCCCGAGGGCTTCACCTGGGAGCGCGTGACCCGCTAC 300
>>>> GAGGACGGCGGCGTGGTGACCGTGATGCAGGACACCAGCCTGGAGGACGG 350
>>>> CTGCCTGGTGTACCACGTGCAGGTGCGCGGCGTGAACTTCCCCAGCAACG 400
>>>> GCCCCGTGATGCAGAAGAAGACCAAGGGCTGGGAGCCCAACACCGAGATG 450
>>>> ATGTACCCCGCCGACGGCGGCCTGCGCGGCTACACCCACATGGCCCTGAA 500
>>>> GGTGGACGGCGGCGGCCACCTGAGCTGCAGCTTCGTGACCACCTACCGCA 550
>>>> GCAAGAAGACCGTGGGCAACATCAAGATGCCCGGCATCCACGCCGTGGAC 600
>>>> CACCGCCTGGAGCGCCTGGAGGAGAGCGACAACGAGATGTTCGTGGTGCA 650
>>>> GCGCGAGCACGCCGTGGCCAAGTTCGCCGGCCTGGGCGGCGGCATGGACG 700
>>> AGCTGTACAAG
>>>>
>>>>
>>>> Clover sequence is:
>>>>
>>>> Synthetic construct *green* *fluorescent* protein Clover gene, partial
>>>> cds </nuccore/JX489388.1>
>>>>
>>>> 684 bp linear other-genetic
>>>>
>>>> Accession: JX489388.1
>>>> GI: 404332615
>>>>
>>>> their sequence:
>>>>
>>>> 1 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 61
>>>> ggcgacgtaa acggccacaa gttcagcgtc cgcggcgagg gcgagggcga tgccaccaac 121
>>>> ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 181
>>>> ctcgtgacca ccttcggcta cggcgtggcc tgcttcagcc gctaccccga ccacatgaag 241
>>>> cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatctct 301
>>>> ttcaaggacg acggtaccta caagacccgc gccgaggtga agttcgaggg cgacaccctg 361
>>>> gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 421
>>>> aagctggagt acaacttcaa cagccacaac gtctatatca cggccgacaa gcagaagaac 481
>>>> ggcatcaagg ctaacttcaa gatccgccac aacgttgagg acggcagcgt gcagctcgcc 541
>>>> gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 601
>>>> tacctgagcc atcagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 661
>>>> ctgctggagt tcgtaaccgc cgcc
>>>>
>>>> JCat reported a CAI of 0.79 (1.0 being perfect), and recommended: (CAI
>>>> 0.956):
>>>>
>>>> ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGCGTGGTGCCCATCCTGGT 50
>>>> GGAGCTGGACGGCGACGTGAACGGCCACAAGTTCAGCGTGCGCGGCGAGG 100
>>>> GCGAGGGCGACGCCACCAACGGCAAGCTGACCCTGAAGTTCATCTGCACC 150
>>>> ACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTGGTGACCACCTTCGGCTA 200
>>>> CGGCGTGGCCTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACT 250
>>>> TCTTCAAGAGCGCCATGCCCGAGGGCTACGTGCAGGAGCGCACCATCAGC 300
>>>> TTCAAGGACGACGGCACCTACAAGACCCGCGCCGAGGTGAAGTTCGAGGG 350
>>>> CGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG 400
>>>> ACGGCAACATCCTGGGCCACAAGCTGGAGTACAACTTCAACAGCCACAAC 450
>>>> GTGTACATCACCGCCGACAAGCAGAAGAACGGCATCAAGGCCAACTTCAA 500
>>>> GATCCGCCACAACGTGGAGGACGGCAGCGTGCAGCTGGCCGACCACTACC 550
>>>> AGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCAC 600
>>>> TACCTGAGCCACCAGAGCGCCCTGAGCAAGGACCCCAACGAGAAGCGCGA 650
>>>> CCACATGGTGCTGCTGGAGTTCGTGACCGCCGCC
>>>>
>>>>
>>>>
>>>> at 711 bases - each, you might find it cost effective to simply order
>>>> this (or pick your favorite optimizer ... or optimize for your
>>>> favorite organism) sequence from some DNA synthesis company.
>>>>
>>>> If the company charges by the gene, you could stick in a short linker
>>>> (see the paper, or use Steven Vogel's sequence in C5V or in between
>>>> his V's of V6) and have 711+(say)15+711 base sequence synthesized. If
>>>> you posted that plasmid to addgene.org, and mentioned codon optimized
>>>> for human (and maybe stuck on a promoter or maximized Gateway
>>>> compatibility), would probably lead to being your most popular addgene
>>>> construct and (when you publish it) most referenced technical paper.
>>>>
>>>> Enjoy,
>>>>
>>>> George
>>>>
>>>>
>>>> On 9/16/2012 12:28 PM, Roger Phillips wrote:
>>>>> Dear George,
>>>>> Have you looked at lifetime kinetics in the transfer from Clover to
>>> mRuby2?  I only have access to the paper copy of Nature Methods so won't
>>> read the details till next month. We are about to shift from fixed to
>>> live cell
>>> imaging and we need to choose labels for [] and [].  Are the vectors for
>>> fusion construction and for controls (Clover-mRuby2 tandem construct in
>>> sup fig 9 and unfused Clover and mRuby2 available?
>>>>> Thanks for your work,
>>>>> Roger Phillips
>>>>>
>>>>> Dr Roger Guy Phillips
>>>>> Centre for Advanced Microscopy,
>>>>> University of Sussex
>>>>> School of Life Sciences
>>>>> John Maynard Smith Building
>>>>> Falmer, Brighton&  Hove
>>>>> BN1 9QG
>>>>> United Kingdom
>>>>>
>>>>> phone:[phone]
>>>>> fax: [phone]
>>>>> email:[hidden email]
>>>>> room:2C9 (ext 7585)/lab 4C2 (ext 2734)
>>>>>
>>>>>
>>>>>
>>>>>
>>>>> -----Original Message-----
>>>>> From: Confocal Microscopy List
>>>>> [mailto:[hidden email]] On Behalf Of George
>>>>> McNamara
>>>>> Sent: 15 September 2012 01:33
>>>>> To:[hidden email]
>>>>> Subject: Clover and mRuby2 FPs ... Re: Background fluorescence
>>>>> problem
>>>>>
>>>>> *****
>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>> *****
>>>>>
>>>>> Hi Kurt,
>>>>>
>>>>> Clover and mruby2 are described in the Lam et al paper at Nature
>>>>> Methods
>>>>>
>>>>>
>>> http://www.nature.com/nmeth/journal/vaop/ncurrent/full/nmeth.2171.ht
>>> m
>>>>> l
>>>>>
>>>>> A variety of genetically encoded reporters use changes in
>>>>> fluorescence (or Förster) resonance energy transfer (FRET) to report
>>>>> on
>>> biochemical processes in living cells. The standard genetically encoded
>>> FRET
>>> pair consists of CFPs and YFPs, but many CFP-YFP reporters suffer from
>>> low
>>> FRET dynamic range, phototoxicity from the CFP excitation light and
>>> complex photokinetic events such as reversible photobleaching and
>>> photoconversion. We engineered two fluorescent proteins, Clover and
>>> mRuby2, which are the brightest green and red fluorescent proteins to
>>> date
>>> and have the highest Förster radius of any ratiometric FRET pair yet
>>> described. Replacement of CFP and YFP with these two proteins in
>>> reporters
>>> of kinase activity, small GTPase activity and transmembrane voltage
>>> significantly improves photostability, FRET dynamic range and emission
>>> ratio changes. These improvements enhance detection of transient
>>> biochemical events such as neuronal action-potential firing and RhoA act
>>> ivation in growth cones.
>>>>>
>>>>>
>>>>>
>>>>> On 9/14/2012 2:58 PM, Kurt Thorn wrote:
>>>>>
>>>>>> *****
>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>> *****
>>>>>>
>>>>>> What is Clover GFP? I can't find much information about it on Google.
>>>>>>
>>>>>> Thanks,
>>>>>> Kurt
>>>>>>
>>>>>> On 9/14/2012 3:49 AM, George McNamara wrote:
>>>>>>
>>>>>>> *****
>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>>> *****
>>>>>>>
>>>>>>> Hi Simon,
>>>>>>>
>>>>>>> Your cells might not need the 100x excess of riboflavin present in
>>>>>>> "standard" DMEM, your background could be reduced. The Essen tech
>>>>>>> note I mentioned lists:
>>>>>>> DMEM 0.4 mg/L riboflavin ... 43.6 units fluorescence
>>>>>>> Eagles MEM 0.1 mg/mL     ... 12.9
>>>>>>> F12K            0.04               ... 5.4
>>>>>>> EBM             0.004             ... 3.7
>>>>>>> Riboflavin (alone) 0.4          ... 58.7 (perhaps suggesting that
>>>>>>> culture media quenches riboflavin or it gets converted in part to
>>>>>>> something less fluorescent?) Contact Essen if you want the entire
>>>>>>> tech note.
>>>>>>>
>>>>>>>
>>>>>>> If you absolutely require a green fluorescent protein, spend the
>>>>>>> time to switch to the new Clover or "V6" from Steven Vogel
>>>>>>> (available from addgene.org as VVVVVV).
>>>>>>> If you do not need green, switch to tdTomato or the new mRuby2.
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>> Create File
>>>>>>> Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. [Epub ahead of
>>>>>>> print]
>>>>>>>
>>>>>>>
>>>>>>> Improving FRET dynamic range with bright green and red
>>>>>>> fluorescent proteins.
>>>>>>>
>>>>>>> Lam AJ (et al)
>>>>>>>
>>>>>>>     Abstract
>>>>>>>
>>>>>>> A variety of genetically encoded reporters use changes in
>>>>>>> fluorescence resonance energy transfer (FRET) to report on
>>>>>>> biochemical processes in living cells. The standard genetically
>>>>>>> encoded FRET pair consists of CFPs and YFPs, but many CFP-YFP
>>>>>>> reporters suffer from low FRET dynamic range, phototoxicity from
>>>>>>> the CFP excitation light and complex photokinetic events such as
>>>>>>> reversible photobleaching and photoconversion. We engineered two
>>>>>>> fluorescent proteins,* Clover and mRuby2*, which are the brightest
>>>>>>> green and red fluorescent proteins to date and have the highest
>>>>>>> Förster radius of any ratiometric FRET pair yet described.
>>>>>>> Replacement of CFP and YFP with these two proteins in reporters of
>>>>>>> kinase activity, small GTPase activity and transmembrane voltage
>>>>>>> significantly improves photostability, FRET dynamic range and
>>>>>>> emission ratio changes. These improvements enhance detection of
>>>>>>> transient biochemical events such as neuronal action-potential
>>>>>>> firing and RhoA activation in growth cones.
>>>>>>>
>>>>>>> PMID:
>>>>>>>   22961245
>>>>>>>
>>>>>>>
>>>>>>> PLoS One.<#>  2012;7(5):e38209. Epub 2012 May 30.
>>>>>>>
>>>>>>>
>>>>>>> Fluorescence polarization and fluctuation analysis monitors
>>>>>>> subunit proximity, stoichiometry, and protein complex hydrodynamics.
>>>>>>>
>>>>>>> Nguyen TA ...  Vogel SS
>>>>>>>
>>>>>>>     Abstract
>>>>>>>
>>>>>>> Förster resonance energy transfer (FRET) microscopy is frequently
>>>>>>> used to study protein interactions and conformational changes in
>>>>>>> living cells. The utility of FRET is limited by false positive and
>>>>>>> negative signals. To overcome these limitations we have developed
>>>>>>> Fluorescence Polarization and Fluctuation Analysis (FPFA), a hybrid
>>>>>>> single-molecule based method combining time-resolved fluorescence
>>>>>>> anisotropy (homo-FRET) and fluorescence correlation spectroscopy.
>>>>>>> Using FPFA, homo-FRET (a 1-10 nm proximity gauge), brightness (a
>>>>>>> measure of the number of fluorescent subunits in a complex), and
>>>>>>> correlation time (an attribute sensitive to the mass and shape of a
>>>>>>> protein complex) can be simultaneously measured. These
>>> measurements
>>>>>>> together rigorously constrain the interpretation of FRET signals.
>>>>>>> Venus based control-constructs were used to validate FPFA. The
>>>>>>> utility of FPFA was demonstrated by measuring in living cells the
>>>>>>> number of subunits in the ?-isoform of Venus-tagged
>>>>>>> calcium-calmodulin dependent protein kinase-II (CaMKII?)
>>> holoenzyme.
>>>>>>> Brightness analysis revealed that the holoenzyme has, on average,
>>>>>>> 11.9 ± 1.2 subunit, but values ranged from 10-14 in individual
>>>>>>> cells.
>>>>>>> Homo-FRET analysis simultaneously detected that catalytic domains
>>>>>>> were arranged as dimers in the dodecameric holoenzyme, and this
>>>>>>> paired organization was confirmed by quantitative hetero-FRET
>>>>>>> analysis. In freshly prepared cell homogenates FPFA detected only
>>>>>>> 10.2 ± 1.3 subunits in the holoenzyme with values ranging from 9-12.
>>>>>>> Despite the reduction in subunit number, catalytic domains were
>>>>>>> still arranged as pairs in homogenates. Thus, FPFA suggests that
>>>>>>> while the absolute number of subunits in an auto-inhibited
>>>>>>> holoenzyme might vary from cell to cell, the organization of
>>>>>>> catalytic domains into pairs is preserved.
>>>>>>>
>>>>>>> PMID:
>>>>>>>   22666486
>>>>>>>
>>>>>>>
>>>>>>> I am a bit disappointed Vogel's group did not go for V8 (a well
>>>>>>> known
>>>>>>> drink) or V12 - the latter either as a polypeptide or with
>>>>>>> inducible dimerization domain. V12 since the goal of this paper is
>>>>>>> to quantify the number of subunits in CaMKIIalpha, which turns out
>>>>>>> to be 12 (+/- a few) as described in
>>>>>>> http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3364239/figure/pone-
>>> 003
>>>>>>> 82
>>>>>>> 09-g004/
>>>>>>>
>>>>>>>
>>>>>>> On 9/14/2012 4:32 AM, simon walker wrote:
>>>>>>>
>>>>>>>> *****
>>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>>>> *****
>>>>>>>>
>>>>>>>> Thanks for the various responses.  Yes, I'd seen the Bogdanov
>>>>>>>> paper and the Evrogen medium and thought that might be worth a
>>>>>>>> try.  The problem we have is that for our assay the culture medium
>>>>>>>> is absolutely critical (it's not just a case of keeping cells
>>>>>>>> alive), so we can't use a minimal HEPES-based buffer.  I am
>>>>>>>> interested to know what is in the 'BackDrop' solution.  We can't
>>>>>>>> use it unless we're fairly confident it's not going to affect our
>>>>>>>> assay.
>>>>>>>> Simon
>>>>>>>>
>>>>>>>>
>>>>>>>> -----Original Message-----
>>>>>>>> From: Confocal Microscopy List
>>>>>>>> [mailto:[hidden email]] On Behalf Of
>>> George
>>>>>>>> McNamara
>>>>>>>> Sent: 14 September 2012 01:57
>>>>>>>> To:[hidden email]
>>>>>>>> Subject: Re: Background fluorescence problem
>>>>>>>>
>>>>>>>> *****
>>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>>>> *****
>>>>>>>>
>>>>>>>> Hi Simon,
>>>>>>>>
>>>>>>>> likely riboflavin and possibly other flavins. See
>>>>>>>>
>>> http://www.evrogen.com/products/medium_DMEM_gfp/medium_DMEM_
>>> gfp.sh
>>>>>>>> tm l and the Bogdanov et al paper referenced  at the bottom of the
>>>>>>>> page;
>>>>>>>>
>>>>>>>>     * Bogdanov AM, Bogdanova EA, Chudakov DM, Gorodnicheva TV,
>>>>>>>> Lukyanov
>>>>>>>>       S, Lukyanov KA. Cell culture medium affects GFP
>>>>>>>> photostability: a
>>>>>>>>       solution. Nat Methods. 2009; 6 (12):859-60. / pmid:
>>>>>>>> 19935837
>>>>>>>>
>>> <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Pub
>>>>>>>> Me d&list_uids=19935837&dopt=Abstract>
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>> Their solution: incubate cells in miedia without (or with low, if
>>>>>>>> needed) riboflavin for a day.
>>>>>>>>
>>>>>>>> As a bonus, riboflavin quenches (FRET?) and/or transiently
>>>>>>>> photoconverts GFP to red fluorescence (might be mostly dark
>>>>>>>> states):
>>>>>>>>
>>>>>>>> Condensed mitotic chromosome structure at nanometer resolution
>>>>>>>> using PALM and EGFP- histones.</pubmed/20856676>* Matsuda* A,
>>> Shao
>>>>>>>> L, Boulanger J, Kervrann C, Carlton PM, Kner P, Agard D, *Sedat*
>>>>>>>> JW.
>>>>>>>> PLoS One. 2010 Sep 15;5(9):e12768. PMID: 20856676
>>>>>>>>
>>>>>>>>
>>>>>>>> If you contact Essen Biosciences, they will (hopefully) give you a
>>>>>>>> copy of their application note on the concentrations of riboflavin
>>>>>>>> in many culture media and correlation with fluorescence of those
>>>>>>>> media. Speaking of Essen - they finally introduced a dual
>>>>>>>> green+red fluorescence Incucyte.
>>>>>>>>
>>>>>>>> Enjoy,
>>>>>>>>
>>>>>>>> George
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>> On 9/13/2012 11:04 AM, Simon Walker wrote:
>>>>>>>>
>>>>>>>>> *****
>>>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>>>>> *****
>>>>>>>>>
>>>>>>>>> Dear List,
>>>>>>>>> We are imaging very weakly fluorescent live cells (expressing
>>>>>>>>> GFP) on a wide- field system and having issues with a source of
>>>>>>>>> background fluorescence.
>>>>>>>>> When we look at our cells under epi-illumination we see a rapid
>>>>>>>>> drop in a weak background signal (not where the cells are) that
>>>>>>>>> fully recovers over a ~10 s period after the illumination light
>>>>>>>>> is switched off.  Our experiments require the use of DMEM as the
>>>>>>>>> imaging medium and this is the likely cause of problem.  It
>>>>>>>>> appears that something in the medium is sticking to the
>>>>>>>>> coverglass.  It's not phenol red as the effect is seen with both
>>>>>>>>> phenol red-containing and phenol- red-free DMEM.  Does anyone
>>>>>>>>> know what else it could be?  Has anyone else seen anything
>>>>>>>>> similar?  We're wondering if it could be riboflavin which is in
>>>>>>>>> the
>>> DMEM we're using.  Would this stick to glass?
>>>>>>>>>
>>>>>>>>> I've seen that Life Technologies now market a substance that
>>>>>>>>> allegedly surpresses background fluorescence in DMEM:
>>>>>>>>> http://products.invitrogen.com/ivgn/product/R37603
>>>>>>>>> Has anyone tried this?  Does anyone know how it works?
>>>>>>>>>
>>>>>>>>> Thanks,
>>>>>>>>> Simon
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>> The Babraham Institute, Babraham Research Campus, Cambridge CB22
>>>>>>>> 3AT Registered Charity No. 1053902.
>>>>>>>> The information transmitted in this email is directed only to the
>>>>>>>> addressee. If you received this in error, please contact the
>>>>>>>> sender and delete this email from your system. The contents of
>>>>>>>> this e-mail are the views of the sender and do not necessarily
>>>>>>>> represent the views of the Babraham Institute. Full conditions at:
>>>>>>>>
>>> www.babraham.ac.uk<http://www.babraham.ac.uk/email_disclaimer.html
>>>>
>>