Re: Codon optimization WAS: RE: Clover and mRuby2 FPs ... Re: Background fluorescence problem

Posted by Dolphin, Colin on
URL: http://confocal-microscopy-list.275.s1.nabble.com/Background-fluorescence-problem-tp7579031p7579183.html

*****
To join, leave or search the confocal microscopy listserv, go to:
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
*****

We spent sometime designing codon-optimized FPs for expression in C.
elegans and found, in two out of three cases, that in otherwise equivalent
transgenic animals, codon-optimized FP expression was severely compromised
in comparison to the 'established' coding sequences that had been, and
still are, used in worms since their initial development as reporters. As
well as being different with respect to codon use our 'codon-optimized'
sequences had two, unequally spaced artificial introns whereas the
otherwise equivalent but non 'codon-optimized' coding sequences all had
three equally spaced introns. We might just have been unlucky but I think
there are other variables - such as use, number and placement of introns -
that may as important, if not more so. 'Codon-optimization' may not be the
only thing to consider and, as such, in some situations it may be a case
of 'if it aint broke don't fix it'!
 


Colin

On 17/10/2012 10:54, "Tobias Rose" <[hidden email]> wrote:

>*****
>To join, leave or search the confocal microscopy listserv, go to:
>http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>*****
>
>Hi everybody,
>
>Sorry to warm up this old thread and please excuse the lengthy post - but
>I am about to do precisely what George suggested: Synthesize mRuby2.
>(well: without the publish to addgene and try to snatch citations away
>from R. Tsien bit...). And by the way: All plasmids from that publication
>are available on addgene now: http://www.addgene.org/browse/article/5906/
>.
>Be aware that there are quite a few tags on the N-terminus of mRuby2...
>
>The question that I am asking myself for a while now is:
>Is codon optimization really worth it?
>
>Due to lack of time and to increase turnover I am by now synthesizing
>most of my DNA. With the breakneck speed that fluorescent proteins and
>genetically encoded functional indicators are developed right now it's
>almost impossible to keep up without synthesis. And it¹s also very
>convenient...
>
>However: besides all the PR talk of synthesis companies I don't really
>know if codon optimization (for mouse in my case) would do more harm than
>good. For instance, next to all the semi-anecdotal optimization papers
>out there there is still this Science paper here:
>
>Coding-Sequence Determinants of Gene Expression in Escherichia coli
>Grzegorz Kudla, Andrew W. Murray, David Tollervey, and Joshua B. Plotkin
>Science 10 April 2009: 324 (5924), 255-258. [DOI:10.1126/science.1170160]
>
>At least in e. coli codon usage appears to not matter at all (see also
>discussion here:
>http://omicsomics.blogspot.de/2009/04/is-codon-optimization-bunk.html ).
>
>Also, even though I cannot judge it, it's stated in my 'AAV cookbook':
>"[...It should be noted, however, that the potential for introduction of
>sequences that negatively affect gene expression is also a risk with this
>process, and it is difficult to predict which sequences will have such an
>effect. For example, it has been shown that the sequences coding for
>protein domain boundaries are more likely to be coded by ³translationally
>slow² codons [...]"
>Gray, J. T. & Zolotukhin, S. Adeno-Associated Virus. 807, 25­46 (2011).
>
>Right now I don't even know if the run of the mill XFPs available from
>addgene or Tsien himself _are_ in any way codon-optimized away from the
>original species towards mammalian use.
>
>Whould you say that it makes sense, for example, to further 'optimize'
>very established sequences like standard XFPs (in my case for tdtomato
>and GCaMPx (genetically-encoded Ca2+ indicator [GFP + calmodulin +
>M13peptide])?  The problem with the CAI score that George posted (next to
>the fact that that's only one out of many ways to codon optimize) is that
>I'm getting entirely different CAI scores from different calculators and
>especially also for different mammalian species  (e.g. human vs. mouse -
>is codon usage really that different here?):
>
>Example:
>mRUBY2 CDS
>
>www.jcat.de
>human
>before opt:
>CAI 0.27
>
>After opt:
>CAI 0.95
>
>Mouse (my target):
>before opt
>CAI 0.23
>
>after opt:
>CAI 0.72
>
>Same sequence with genscript:
>http://www.genscript.com/cgi-bin/tools/rare_codon_analysis
>
>human
>before opt
>CAI : 0.75
>
>Mouse
>before opt
>CAI : 0.75
>
>As usual, optimisation is proprietary hereŠ and might be biased towards
>ease of synthesis and not necessary towards best possible expression.
>
>And then there is the entirely different optimization from other
>companies like DNA2.0...
>
>What is your opinion: voodoo or not? Would you change 'established'
>sequences to increase expression - or would you just optimize when you
>switch species?
>
>Thanks,T
>
>Also: What's your bet - is mRuby2 the best red/orange protein ever -- or
>would you still use mCherry or (td)tomato in spite of all the
>cytotoxicity rumours?
>
>
>
>
>
>
>> -----Original Message-----
>> From: Confocal Microscopy List
>> [mailto:[hidden email]] On Behalf Of George
>> McNamara
>> Sent: Sunday, September 16, 2012 7:21 PM
>> To: [hidden email]
>> Subject: Re: Clover and mRuby2 FPs ... Re: Background fluorescence
>> problem
>>
>> *****
>> To join, leave or search the confocal microscopy listserv, go to:
>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> *****
>>
>>
>> > Hi Roger,
>> >
>> > These are not my FP's!  I read the paper a couple of days ago and
>> > thought it worth mentioning to the listserv.
>> >
>> > The paper states that the plasmids will be available at addgene.org -
>> > presumably (ok, hopefully) in sync with the print edition official
>> > publication date.
>> >
>> > If you are in a hurry, you could contact the PI to try to get the
>> > plasmids early (i.e. offer to provide your fedex number).
>> >
>> > I did not see mRuby in addgene.org either. The original mRuby paper is
>> > PMID:  19194514.
>> >
>> > The mRuby2 DNA sequence is available online at NCBI Nucleotide (search
>> > term: http://www.ncbi.nlm.nih.gov/nuccore?term=eqFP611      )
>> >
>> > Synthetic construct red fluorescent protein Ruby2 gene, partial cds
>> > </nuccore/JX489389.1>
>> >
>> > 711 bp linear other-genetic
>> >
>> > Accession: JX489389.1
>> >     GI: 404332617
>> >
>> > atggtgtcta agggcgaaga gctgatcaag gaaaatatgc gtatgaaggt ggtcatggaa 61
>> > ggttcggtca acggccacca attcaaatgc acaggtgaag gagaaggcaa tccgtacatg 121
>> > ggaactcaaa ccatgaggat caaagtcatc gagggaggac ccctgccatt tgcctttgac 181
>> > attcttgcca cgtcgttcat gtatggcagc cgtactttta tcaagtaccc gaaaggcatt 241
>> > cctgatttct ttaaacagtc ctttcctgag ggttttactt gggaaagagt tacgagatac 301
>> > gaagatggtg gagtcgtcac cgtcatgcag gacaccagcc ttgaggatgg ctgtctcgtt 361
>> > taccacgtcc aagtcagagg ggtaaacttt ccctccaatg gtcccgtgat gcagaagaag 421
>> > accaagggtt gggagcctaa tacagagatg atgtatccag cagatggtgg tctgagggga 481
>> > tacactcata tggcactgaa agttgatggt ggtggccatc tgtcttgctc tttcgtaaca 541
>> > acttacaggt caaaaaagac cgtcgggaac atcaagatgc ccggtatcca tgccgttgat 601
>> > caccgcctgg aaaggttaga ggaaagtgac aatgaaatgt tcgtagtaca acgcgaacac 661
>> > gcagttgcca agttcgccgg gcttggtggt gggatggacg agctgtacaa g
>> >
>> >
>> > I ran the above mRuby2 DNA sequence through one of the free online
>> > codon optimization programs - www.jcat.de   which gave a low CAI score
>> > (CAI 0.27) when I asked for human optimization.
>> >
>> > jcat recommends (CAI 0.96, a typical optimized score):
>> >
>> > ATGGTGAGCAAGGGCGAGGAGCTGATCAAGGAGAACATGCGCATGAAGGT 50
>> > GGTGATGGAGGGCAGCGTGAACGGCCACCAGTTCAAGTGCACCGGCGAGG 100
>> > GCGAGGGCAACCCCTACATGGGCACCCAGACCATGCGCATCAAGGTGATC 150
>> > GAGGGCGGCCCCCTGCCCTTCGCCTTCGACATCCTGGCCACCAGCTTCAT 200
>> > GTACGGCAGCCGCACCTTCATCAAGTACCCCAAGGGCATCCCCGACTTCT 250
>> > TCAAGCAGAGCTTCCCCGAGGGCTTCACCTGGGAGCGCGTGACCCGCTAC 300
>> > GAGGACGGCGGCGTGGTGACCGTGATGCAGGACACCAGCCTGGAGGACGG 350
>> > CTGCCTGGTGTACCACGTGCAGGTGCGCGGCGTGAACTTCCCCAGCAACG 400
>> > GCCCCGTGATGCAGAAGAAGACCAAGGGCTGGGAGCCCAACACCGAGATG 450
>> > ATGTACCCCGCCGACGGCGGCCTGCGCGGCTACACCCACATGGCCCTGAA 500
>> > GGTGGACGGCGGCGGCCACCTGAGCTGCAGCTTCGTGACCACCTACCGCA 550
>> > GCAAGAAGACCGTGGGCAACATCAAGATGCCCGGCATCCACGCCGTGGAC 600
>> > CACCGCCTGGAGCGCCTGGAGGAGAGCGACAACGAGATGTTCGTGGTGCA 650
>> > GCGCGAGCACGCCGTGGCCAAGTTCGCCGGCCTGGGCGGCGGCATGGACG 700
>> AGCTGTACAAG
>> >
>> >
>> > Clover sequence is:
>> >
>> > Synthetic construct *green* *fluorescent* protein Clover gene, partial
>> > cds </nuccore/JX489388.1>
>> >
>> > 684 bp linear other-genetic
>> >
>> > Accession: JX489388.1
>> > GI: 404332615
>> >
>> > their sequence:
>> >
>> > 1 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 61
>> > ggcgacgtaa acggccacaa gttcagcgtc cgcggcgagg gcgagggcga tgccaccaac 121
>> > ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 181
>> > ctcgtgacca ccttcggcta cggcgtggcc tgcttcagcc gctaccccga ccacatgaag 241
>> > cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatctct 301
>> > ttcaaggacg acggtaccta caagacccgc gccgaggtga agttcgaggg cgacaccctg 361
>> > gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 421
>> > aagctggagt acaacttcaa cagccacaac gtctatatca cggccgacaa gcagaagaac 481
>> > ggcatcaagg ctaacttcaa gatccgccac aacgttgagg acggcagcgt gcagctcgcc 541
>> > gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 601
>> > tacctgagcc atcagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 661
>> > ctgctggagt tcgtaaccgc cgcc
>> >
>> > JCat reported a CAI of 0.79 (1.0 being perfect), and recommended: (CAI
>> > 0.956):
>> >
>> > ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGCGTGGTGCCCATCCTGGT 50
>> > GGAGCTGGACGGCGACGTGAACGGCCACAAGTTCAGCGTGCGCGGCGAGG 100
>> > GCGAGGGCGACGCCACCAACGGCAAGCTGACCCTGAAGTTCATCTGCACC 150
>> > ACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTGGTGACCACCTTCGGCTA 200
>> > CGGCGTGGCCTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACT 250
>> > TCTTCAAGAGCGCCATGCCCGAGGGCTACGTGCAGGAGCGCACCATCAGC 300
>> > TTCAAGGACGACGGCACCTACAAGACCCGCGCCGAGGTGAAGTTCGAGGG 350
>> > CGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG 400
>> > ACGGCAACATCCTGGGCCACAAGCTGGAGTACAACTTCAACAGCCACAAC 450
>> > GTGTACATCACCGCCGACAAGCAGAAGAACGGCATCAAGGCCAACTTCAA 500
>> > GATCCGCCACAACGTGGAGGACGGCAGCGTGCAGCTGGCCGACCACTACC 550
>> > AGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCAC 600
>> > TACCTGAGCCACCAGAGCGCCCTGAGCAAGGACCCCAACGAGAAGCGCGA 650
>> > CCACATGGTGCTGCTGGAGTTCGTGACCGCCGCC
>> >
>> >
>> >
>> > at 711 bases - each, you might find it cost effective to simply order
>> > this (or pick your favorite optimizer ... or optimize for your
>> > favorite organism) sequence from some DNA synthesis company.
>> >
>> > If the company charges by the gene, you could stick in a short linker
>> > (see the paper, or use Steven Vogel's sequence in C5V or in between
>> > his V's of V6) and have 711+(say)15+711 base sequence synthesized. If
>> > you posted that plasmid to addgene.org, and mentioned codon optimized
>> > for human (and maybe stuck on a promoter or maximized Gateway
>> > compatibility), would probably lead to being your most popular addgene
>> > construct and (when you publish it) most referenced technical paper.
>> >
>> > Enjoy,
>> >
>> > George
>> >
>> >
>> > On 9/16/2012 12:28 PM, Roger Phillips wrote:
>> >> Dear George,
>> >> Have you looked at lifetime kinetics in the transfer from Clover to
>> mRuby2?  I only have access to the paper copy of Nature Methods so won't
>> read the details till next month. We are about to shift from fixed to
>>live cell
>> imaging and we need to choose labels for [] and [].  Are the vectors for
>> fusion construction and for controls (Clover-mRuby2 tandem construct in
>> sup fig 9 and unfused Clover and mRuby2 available?
>> >> Thanks for your work,
>> >> Roger Phillips
>> >>
>> >> Dr Roger Guy Phillips
>> >> Centre for Advanced Microscopy,
>> >> University of Sussex
>> >> School of Life Sciences
>> >> John Maynard Smith Building
>> >> Falmer, Brighton&  Hove
>> >> BN1 9QG
>> >> United Kingdom
>> >>
>> >> phone:[phone]
>> >> fax: [phone]
>> >> email:[hidden email]
>> >> room:2C9 (ext 7585)/lab 4C2 (ext 2734)
>> >>
>> >>
>> >>
>> >>
>> >> -----Original Message-----
>> >> From: Confocal Microscopy List
>> >> [mailto:[hidden email]] On Behalf Of George
>> >> McNamara
>> >> Sent: 15 September 2012 01:33
>> >> To:[hidden email]
>> >> Subject: Clover and mRuby2 FPs ... Re: Background fluorescence
>> >> problem
>> >>
>> >> *****
>> >> To join, leave or search the confocal microscopy listserv, go to:
>> >> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> >> *****
>> >>
>> >> Hi Kurt,
>> >>
>> >> Clover and mruby2 are described in the Lam et al paper at Nature
>> >> Methods
>> >>
>> >>
>> http://www.nature.com/nmeth/journal/vaop/ncurrent/full/nmeth.2171.ht
>> m
>> >> l
>> >>
>> >> A variety of genetically encoded reporters use changes in
>> >> fluorescence (or Förster) resonance energy transfer (FRET) to report
>>on
>> biochemical processes in living cells. The standard genetically encoded
>>FRET
>> pair consists of CFPs and YFPs, but many CFP-YFP reporters suffer from
>>low
>> FRET dynamic range, phototoxicity from the CFP excitation light and
>> complex photokinetic events such as reversible photobleaching and
>> photoconversion. We engineered two fluorescent proteins, Clover and
>> mRuby2, which are the brightest green and red fluorescent proteins to
>>date
>> and have the highest Förster radius of any ratiometric FRET pair yet
>> described. Replacement of CFP and YFP with these two proteins in
>>reporters
>> of kinase activity, small GTPase activity and transmembrane voltage
>> significantly improves photostability, FRET dynamic range and emission
>> ratio changes. These improvements enhance detection of transient
>> biochemical events such as neuronal action-potential firing and RhoA act
>> ivation in growth cones.
>> >>
>> >>
>> >>
>> >> On 9/14/2012 2:58 PM, Kurt Thorn wrote:
>> >>
>> >>> *****
>> >>> To join, leave or search the confocal microscopy listserv, go to:
>> >>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> >>> *****
>> >>>
>> >>> What is Clover GFP? I can't find much information about it on
>>Google.
>> >>>
>> >>> Thanks,
>> >>> Kurt
>> >>>
>> >>> On 9/14/2012 3:49 AM, George McNamara wrote:
>> >>>
>> >>>> *****
>> >>>> To join, leave or search the confocal microscopy listserv, go to:
>> >>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> >>>> *****
>> >>>>
>> >>>> Hi Simon,
>> >>>>
>> >>>> Your cells might not need the 100x excess of riboflavin present in
>> >>>> "standard" DMEM, your background could be reduced. The Essen tech
>> >>>> note I mentioned lists:
>> >>>> DMEM 0.4 mg/L riboflavin ... 43.6 units fluorescence
>> >>>> Eagles MEM 0.1 mg/mL     ... 12.9
>> >>>> F12K            0.04               ... 5.4
>> >>>> EBM             0.004             ... 3.7
>> >>>> Riboflavin (alone) 0.4          ... 58.7 (perhaps suggesting that
>> >>>> culture media quenches riboflavin or it gets converted in part to
>> >>>> something less fluorescent?) Contact Essen if you want the entire
>> >>>> tech note.
>> >>>>
>> >>>>
>> >>>> If you absolutely require a green fluorescent protein, spend the
>> >>>> time to switch to the new Clover or "V6" from Steven Vogel
>> >>>> (available from addgene.org as VVVVVV).
>> >>>> If you do not need green, switch to tdTomato or the new mRuby2.
>> >>>>
>> >>>>
>> >>>>
>> >>>> Create File
>> >>>> Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. [Epub ahead of
>> >>>> print]
>> >>>>
>> >>>>
>> >>>>   Improving FRET dynamic range with bright green and red
>> >>>> fluorescent proteins.
>> >>>>
>> >>>> Lam AJ (et al)
>> >>>>
>> >>>>       Abstract
>> >>>>
>> >>>> A variety of genetically encoded reporters use changes in
>> >>>> fluorescence resonance energy transfer (FRET) to report on
>> >>>> biochemical processes in living cells. The standard genetically
>> >>>> encoded FRET pair consists of CFPs and YFPs, but many CFP-YFP
>> >>>> reporters suffer from low FRET dynamic range, phototoxicity from
>> >>>> the CFP excitation light and complex photokinetic events such as
>> >>>> reversible photobleaching and photoconversion. We engineered two
>> >>>> fluorescent proteins,* Clover and mRuby2*, which are the brightest
>> >>>> green and red fluorescent proteins to date and have the highest
>> >>>> Förster radius of any ratiometric FRET pair yet described.
>> >>>> Replacement of CFP and YFP with these two proteins in reporters of
>> >>>> kinase activity, small GTPase activity and transmembrane voltage
>> >>>> significantly improves photostability, FRET dynamic range and
>> >>>> emission ratio changes. These improvements enhance detection of
>> >>>> transient biochemical events such as neuronal action-potential
>> >>>> firing and RhoA activation in growth cones.
>> >>>>
>> >>>> PMID:
>> >>>>     22961245
>> >>>>
>> >>>>
>> >>>> PLoS One.<#>  2012;7(5):e38209. Epub 2012 May 30.
>> >>>>
>> >>>>
>> >>>>   Fluorescence polarization and fluctuation analysis monitors
>> >>>> subunit proximity, stoichiometry, and protein complex
>>hydrodynamics.
>> >>>>
>> >>>> Nguyen TA ...  Vogel SS
>> >>>>
>> >>>>       Abstract
>> >>>>
>> >>>> Förster resonance energy transfer (FRET) microscopy is frequently
>> >>>> used to study protein interactions and conformational changes in
>> >>>> living cells. The utility of FRET is limited by false positive and
>> >>>> negative signals. To overcome these limitations we have developed
>> >>>> Fluorescence Polarization and Fluctuation Analysis (FPFA), a hybrid
>> >>>> single-molecule based method combining time-resolved fluorescence
>> >>>> anisotropy (homo-FRET) and fluorescence correlation spectroscopy.
>> >>>> Using FPFA, homo-FRET (a 1-10 nm proximity gauge), brightness (a
>> >>>> measure of the number of fluorescent subunits in a complex), and
>> >>>> correlation time (an attribute sensitive to the mass and shape of a
>> >>>> protein complex) can be simultaneously measured. These
>> measurements
>> >>>> together rigorously constrain the interpretation of FRET signals.
>> >>>> Venus based control-constructs were used to validate FPFA. The
>> >>>> utility of FPFA was demonstrated by measuring in living cells the
>> >>>> number of subunits in the ?-isoform of Venus-tagged
>> >>>> calcium-calmodulin dependent protein kinase-II (CaMKII?)
>> holoenzyme.
>> >>>> Brightness analysis revealed that the holoenzyme has, on average,
>> >>>> 11.9 ± 1.2 subunit, but values ranged from 10-14 in individual
>>cells.
>> >>>> Homo-FRET analysis simultaneously detected that catalytic domains
>> >>>> were arranged as dimers in the dodecameric holoenzyme, and this
>> >>>> paired organization was confirmed by quantitative hetero-FRET
>> >>>> analysis. In freshly prepared cell homogenates FPFA detected only
>> >>>> 10.2 ± 1.3 subunits in the holoenzyme with values ranging from
>>9-12.
>> >>>> Despite the reduction in subunit number, catalytic domains were
>> >>>> still arranged as pairs in homogenates. Thus, FPFA suggests that
>> >>>> while the absolute number of subunits in an auto-inhibited
>> >>>> holoenzyme might vary from cell to cell, the organization of
>> >>>> catalytic domains into pairs is preserved.
>> >>>>
>> >>>> PMID:
>> >>>>     22666486
>> >>>>
>> >>>>
>> >>>> I am a bit disappointed Vogel's group did not go for V8 (a well
>> >>>> known
>> >>>> drink) or V12 - the latter either as a polypeptide or with
>> >>>> inducible dimerization domain. V12 since the goal of this paper is
>> >>>> to quantify the number of subunits in CaMKIIalpha, which turns out
>> >>>> to be 12 (+/- a few) as described in
>> >>>> http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3364239/figure/pone-
>> 003
>> >>>> 82
>> >>>> 09-g004/
>> >>>>
>> >>>>
>> >>>> On 9/14/2012 4:32 AM, simon walker wrote:
>> >>>>
>> >>>>> *****
>> >>>>> To join, leave or search the confocal microscopy listserv, go to:
>> >>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> >>>>> *****
>> >>>>>
>> >>>>> Thanks for the various responses.  Yes, I'd seen the Bogdanov
>> >>>>> paper and the Evrogen medium and thought that might be worth a
>> >>>>> try.  The problem we have is that for our assay the culture medium
>> >>>>> is absolutely critical (it's not just a case of keeping cells
>> >>>>> alive), so we can't use a minimal HEPES-based buffer.  I am
>> >>>>> interested to know what is in the 'BackDrop' solution.  We can't
>> >>>>> use it unless we're fairly confident it's not going to affect our
>>assay.
>> >>>>> Simon
>> >>>>>
>> >>>>>
>> >>>>> -----Original Message-----
>> >>>>> From: Confocal Microscopy List
>> >>>>> [mailto:[hidden email]] On Behalf Of
>> George
>> >>>>> McNamara
>> >>>>> Sent: 14 September 2012 01:57
>> >>>>> To:[hidden email]
>> >>>>> Subject: Re: Background fluorescence problem
>> >>>>>
>> >>>>> *****
>> >>>>> To join, leave or search the confocal microscopy listserv, go to:
>> >>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> >>>>> *****
>> >>>>>
>> >>>>> Hi Simon,
>> >>>>>
>> >>>>> likely riboflavin and possibly other flavins. See
>> >>>>>
>> http://www.evrogen.com/products/medium_DMEM_gfp/medium_DMEM_
>> gfp.sh
>> >>>>> tm l and the Bogdanov et al paper referenced  at the bottom of the
>> >>>>> page;
>> >>>>>
>> >>>>>       * Bogdanov AM, Bogdanova EA, Chudakov DM, Gorodnicheva TV,
>> >>>>> Lukyanov
>> >>>>>         S, Lukyanov KA. Cell culture medium affects GFP
>> >>>>> photostability: a
>> >>>>>         solution. Nat Methods. 2009; 6 (12):859-60. / pmid:
>> >>>>> 19935837
>> >>>>>
>> <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Pub
>> >>>>> Me d&list_uids=19935837&dopt=Abstract>
>> >>>>>
>> >>>>>
>> >>>>>
>> >>>>> Their solution: incubate cells in miedia without (or with low, if
>> >>>>> needed) riboflavin for a day.
>> >>>>>
>> >>>>> As a bonus, riboflavin quenches (FRET?) and/or transiently
>> >>>>> photoconverts GFP to red fluorescence (might be mostly dark
>>states):
>> >>>>>
>> >>>>> Condensed mitotic chromosome structure at nanometer resolution
>> >>>>> using PALM and EGFP- histones.</pubmed/20856676>* Matsuda* A,
>> Shao
>> >>>>> L, Boulanger J, Kervrann C, Carlton PM, Kner P, Agard D, *Sedat*
>>JW.
>> >>>>> PLoS One. 2010 Sep 15;5(9):e12768. PMID: 20856676
>> >>>>>
>> >>>>>
>> >>>>> If you contact Essen Biosciences, they will (hopefully) give you a
>> >>>>> copy of their application note on the concentrations of riboflavin
>> >>>>> in many culture media and correlation with fluorescence of those
>> >>>>> media. Speaking of Essen - they finally introduced a dual
>> >>>>> green+red fluorescence Incucyte.
>> >>>>>
>> >>>>> Enjoy,
>> >>>>>
>> >>>>> George
>> >>>>>
>> >>>>>
>> >>>>>
>> >>>>> On 9/13/2012 11:04 AM, Simon Walker wrote:
>> >>>>>
>> >>>>>> *****
>> >>>>>> To join, leave or search the confocal microscopy listserv, go to:
>> >>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> >>>>>> *****
>> >>>>>>
>> >>>>>> Dear List,
>> >>>>>> We are imaging very weakly fluorescent live cells (expressing
>> >>>>>> GFP) on a wide- field system and having issues with a source of
>> >>>>>> background fluorescence.
>> >>>>>> When we look at our cells under epi-illumination we see a rapid
>> >>>>>> drop in a weak background signal (not where the cells are) that
>> >>>>>> fully recovers over a ~10 s period after the illumination light
>> >>>>>> is switched off.  Our experiments require the use of DMEM as the
>> >>>>>> imaging medium and this is the likely cause of problem.  It
>> >>>>>> appears that something in the medium is sticking to the
>> >>>>>> coverglass.  It's not phenol red as the effect is seen with both
>> >>>>>> phenol red-containing and phenol- red-free DMEM.  Does anyone
>> >>>>>> know what else it could be?  Has anyone else seen anything
>> >>>>>> similar?  We're wondering if it could be riboflavin which is in
>>the
>> DMEM we're using.  Would this stick to glass?
>> >>>>>>
>> >>>>>> I've seen that Life Technologies now market a substance that
>> >>>>>> allegedly surpresses background fluorescence in DMEM:
>> >>>>>> http://products.invitrogen.com/ivgn/product/R37603
>> >>>>>> Has anyone tried this?  Does anyone know how it works?
>> >>>>>>
>> >>>>>> Thanks,
>> >>>>>> Simon
>> >>>>>>
>> >>>>>>
>> >>>>>>
>> >>>>> The Babraham Institute, Babraham Research Campus, Cambridge CB22
>> >>>>> 3AT Registered Charity No. 1053902.
>> >>>>> The information transmitted in this email is directed only to the
>> >>>>> addressee. If you received this in error, please contact the
>> >>>>> sender and delete this email from your system. The contents of
>> >>>>> this e-mail are the views of the sender and do not necessarily
>> >>>>> represent the views of the Babraham Institute. Full conditions at:
>> >>>>>
>> www.babraham.ac.uk<http://www.babraham.ac.uk/email_disclaimer.html
>> >
>  
>
>> -----Original Message-----
>> From: Confocal Microscopy List
>> [mailto:[hidden email]] On Behalf Of George
>> McNamara
>> Sent: Sunday, September 16, 2012 7:21 PM
>> To: [hidden email]
>> Subject: Re: Clover and mRuby2 FPs ... Re: Background fluorescence
>> problem
>>
>> *****
>> To join, leave or search the confocal microscopy listserv, go to:
>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>> *****
>>
>>
>>> Hi Roger,
>>>
>>> These are not my FP's!  I read the paper a couple of days ago and
>>> thought it worth mentioning to the listserv.
>>>
>>> The paper states that the plasmids will be available at addgene.org -
>>> presumably (ok, hopefully) in sync with the print edition official
>>> publication date.
>>>
>>> If you are in a hurry, you could contact the PI to try to get the
>>> plasmids early (i.e. offer to provide your fedex number).
>>>
>>> I did not see mRuby in addgene.org either. The original mRuby paper is
>>> PMID:  19194514.
>>>
>>> The mRuby2 DNA sequence is available online at NCBI Nucleotide (search
>>> term: http://www.ncbi.nlm.nih.gov/nuccore?term=eqFP611     )
>>>
>>> Synthetic construct red fluorescent protein Ruby2 gene, partial cds
>>> </nuccore/JX489389.1>
>>>
>>> 711 bp linear other-genetic
>>>
>>> Accession: JX489389.1
>>>    GI: 404332617
>>>
>>> atggtgtcta agggcgaaga gctgatcaag gaaaatatgc gtatgaaggt ggtcatggaa 61
>>> ggttcggtca acggccacca attcaaatgc acaggtgaag gagaaggcaa tccgtacatg 121
>>> ggaactcaaa ccatgaggat caaagtcatc gagggaggac ccctgccatt tgcctttgac 181
>>> attcttgcca cgtcgttcat gtatggcagc cgtactttta tcaagtaccc gaaaggcatt 241
>>> cctgatttct ttaaacagtc ctttcctgag ggttttactt gggaaagagt tacgagatac 301
>>> gaagatggtg gagtcgtcac cgtcatgcag gacaccagcc ttgaggatgg ctgtctcgtt 361
>>> taccacgtcc aagtcagagg ggtaaacttt ccctccaatg gtcccgtgat gcagaagaag 421
>>> accaagggtt gggagcctaa tacagagatg atgtatccag cagatggtgg tctgagggga 481
>>> tacactcata tggcactgaa agttgatggt ggtggccatc tgtcttgctc tttcgtaaca 541
>>> acttacaggt caaaaaagac cgtcgggaac atcaagatgc ccggtatcca tgccgttgat 601
>>> caccgcctgg aaaggttaga ggaaagtgac aatgaaatgt tcgtagtaca acgcgaacac 661
>>> gcagttgcca agttcgccgg gcttggtggt gggatggacg agctgtacaa g
>>>
>>>
>>> I ran the above mRuby2 DNA sequence through one of the free online
>>> codon optimization programs - www.jcat.de   which gave a low CAI score
>>> (CAI 0.27) when I asked for human optimization.
>>>
>>> jcat recommends (CAI 0.96, a typical optimized score):
>>>
>>> ATGGTGAGCAAGGGCGAGGAGCTGATCAAGGAGAACATGCGCATGAAGGT 50
>>> GGTGATGGAGGGCAGCGTGAACGGCCACCAGTTCAAGTGCACCGGCGAGG 100
>>> GCGAGGGCAACCCCTACATGGGCACCCAGACCATGCGCATCAAGGTGATC 150
>>> GAGGGCGGCCCCCTGCCCTTCGCCTTCGACATCCTGGCCACCAGCTTCAT 200
>>> GTACGGCAGCCGCACCTTCATCAAGTACCCCAAGGGCATCCCCGACTTCT 250
>>> TCAAGCAGAGCTTCCCCGAGGGCTTCACCTGGGAGCGCGTGACCCGCTAC 300
>>> GAGGACGGCGGCGTGGTGACCGTGATGCAGGACACCAGCCTGGAGGACGG 350
>>> CTGCCTGGTGTACCACGTGCAGGTGCGCGGCGTGAACTTCCCCAGCAACG 400
>>> GCCCCGTGATGCAGAAGAAGACCAAGGGCTGGGAGCCCAACACCGAGATG 450
>>> ATGTACCCCGCCGACGGCGGCCTGCGCGGCTACACCCACATGGCCCTGAA 500
>>> GGTGGACGGCGGCGGCCACCTGAGCTGCAGCTTCGTGACCACCTACCGCA 550
>>> GCAAGAAGACCGTGGGCAACATCAAGATGCCCGGCATCCACGCCGTGGAC 600
>>> CACCGCCTGGAGCGCCTGGAGGAGAGCGACAACGAGATGTTCGTGGTGCA 650
>>> GCGCGAGCACGCCGTGGCCAAGTTCGCCGGCCTGGGCGGCGGCATGGACG 700
>> AGCTGTACAAG
>>>
>>>
>>> Clover sequence is:
>>>
>>> Synthetic construct *green* *fluorescent* protein Clover gene, partial
>>> cds </nuccore/JX489388.1>
>>>
>>> 684 bp linear other-genetic
>>>
>>> Accession: JX489388.1
>>> GI: 404332615
>>>
>>> their sequence:
>>>
>>> 1 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 61
>>> ggcgacgtaa acggccacaa gttcagcgtc cgcggcgagg gcgagggcga tgccaccaac 121
>>> ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 181
>>> ctcgtgacca ccttcggcta cggcgtggcc tgcttcagcc gctaccccga ccacatgaag 241
>>> cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatctct 301
>>> ttcaaggacg acggtaccta caagacccgc gccgaggtga agttcgaggg cgacaccctg 361
>>> gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 421
>>> aagctggagt acaacttcaa cagccacaac gtctatatca cggccgacaa gcagaagaac 481
>>> ggcatcaagg ctaacttcaa gatccgccac aacgttgagg acggcagcgt gcagctcgcc 541
>>> gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 601
>>> tacctgagcc atcagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 661
>>> ctgctggagt tcgtaaccgc cgcc
>>>
>>> JCat reported a CAI of 0.79 (1.0 being perfect), and recommended: (CAI
>>> 0.956):
>>>
>>> ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGCGTGGTGCCCATCCTGGT 50
>>> GGAGCTGGACGGCGACGTGAACGGCCACAAGTTCAGCGTGCGCGGCGAGG 100
>>> GCGAGGGCGACGCCACCAACGGCAAGCTGACCCTGAAGTTCATCTGCACC 150
>>> ACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTGGTGACCACCTTCGGCTA 200
>>> CGGCGTGGCCTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACT 250
>>> TCTTCAAGAGCGCCATGCCCGAGGGCTACGTGCAGGAGCGCACCATCAGC 300
>>> TTCAAGGACGACGGCACCTACAAGACCCGCGCCGAGGTGAAGTTCGAGGG 350
>>> CGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG 400
>>> ACGGCAACATCCTGGGCCACAAGCTGGAGTACAACTTCAACAGCCACAAC 450
>>> GTGTACATCACCGCCGACAAGCAGAAGAACGGCATCAAGGCCAACTTCAA 500
>>> GATCCGCCACAACGTGGAGGACGGCAGCGTGCAGCTGGCCGACCACTACC 550
>>> AGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCAC 600
>>> TACCTGAGCCACCAGAGCGCCCTGAGCAAGGACCCCAACGAGAAGCGCGA 650
>>> CCACATGGTGCTGCTGGAGTTCGTGACCGCCGCC
>>>
>>>
>>>
>>> at 711 bases - each, you might find it cost effective to simply order
>>> this (or pick your favorite optimizer ... or optimize for your
>>> favorite organism) sequence from some DNA synthesis company.
>>>
>>> If the company charges by the gene, you could stick in a short linker
>>> (see the paper, or use Steven Vogel's sequence in C5V or in between
>>> his V's of V6) and have 711+(say)15+711 base sequence synthesized. If
>>> you posted that plasmid to addgene.org, and mentioned codon optimized
>>> for human (and maybe stuck on a promoter or maximized Gateway
>>> compatibility), would probably lead to being your most popular addgene
>>> construct and (when you publish it) most referenced technical paper.
>>>
>>> Enjoy,
>>>
>>> George
>>>
>>>
>>> On 9/16/2012 12:28 PM, Roger Phillips wrote:
>>>> Dear George,
>>>> Have you looked at lifetime kinetics in the transfer from Clover to
>> mRuby2?  I only have access to the paper copy of Nature Methods so won't
>> read the details till next month. We are about to shift from fixed to
>>live cell
>> imaging and we need to choose labels for [] and [].  Are the vectors for
>> fusion construction and for controls (Clover-mRuby2 tandem construct in
>> sup fig 9 and unfused Clover and mRuby2 available?
>>>> Thanks for your work,
>>>> Roger Phillips
>>>>
>>>> Dr Roger Guy Phillips
>>>> Centre for Advanced Microscopy,
>>>> University of Sussex
>>>> School of Life Sciences
>>>> John Maynard Smith Building
>>>> Falmer, Brighton&  Hove
>>>> BN1 9QG
>>>> United Kingdom
>>>>
>>>> phone:[phone]
>>>> fax: [phone]
>>>> email:[hidden email]
>>>> room:2C9 (ext 7585)/lab 4C2 (ext 2734)
>>>>
>>>>
>>>>
>>>>
>>>> -----Original Message-----
>>>> From: Confocal Microscopy List
>>>> [mailto:[hidden email]] On Behalf Of George
>>>> McNamara
>>>> Sent: 15 September 2012 01:33
>>>> To:[hidden email]
>>>> Subject: Clover and mRuby2 FPs ... Re: Background fluorescence
>>>> problem
>>>>
>>>> *****
>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>> *****
>>>>
>>>> Hi Kurt,
>>>>
>>>> Clover and mruby2 are described in the Lam et al paper at Nature
>>>> Methods
>>>>
>>>>
>> http://www.nature.com/nmeth/journal/vaop/ncurrent/full/nmeth.2171.ht
>> m
>>>> l
>>>>
>>>> A variety of genetically encoded reporters use changes in
>>>> fluorescence (or Förster) resonance energy transfer (FRET) to report
>>>>on
>> biochemical processes in living cells. The standard genetically encoded
>>FRET
>> pair consists of CFPs and YFPs, but many CFP-YFP reporters suffer from
>>low
>> FRET dynamic range, phototoxicity from the CFP excitation light and
>> complex photokinetic events such as reversible photobleaching and
>> photoconversion. We engineered two fluorescent proteins, Clover and
>> mRuby2, which are the brightest green and red fluorescent proteins to
>>date
>> and have the highest Förster radius of any ratiometric FRET pair yet
>> described. Replacement of CFP and YFP with these two proteins in
>>reporters
>> of kinase activity, small GTPase activity and transmembrane voltage
>> significantly improves photostability, FRET dynamic range and emission
>> ratio changes. These improvements enhance detection of transient
>> biochemical events such as neuronal action-potential firing and RhoA act
>> ivation in growth cones.
>>>>
>>>>
>>>>
>>>> On 9/14/2012 2:58 PM, Kurt Thorn wrote:
>>>>
>>>>> *****
>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>> *****
>>>>>
>>>>> What is Clover GFP? I can't find much information about it on Google.
>>>>>
>>>>> Thanks,
>>>>> Kurt
>>>>>
>>>>> On 9/14/2012 3:49 AM, George McNamara wrote:
>>>>>
>>>>>> *****
>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>> *****
>>>>>>
>>>>>> Hi Simon,
>>>>>>
>>>>>> Your cells might not need the 100x excess of riboflavin present in
>>>>>> "standard" DMEM, your background could be reduced. The Essen tech
>>>>>> note I mentioned lists:
>>>>>> DMEM 0.4 mg/L riboflavin ... 43.6 units fluorescence
>>>>>> Eagles MEM 0.1 mg/mL     ... 12.9
>>>>>> F12K            0.04               ... 5.4
>>>>>> EBM             0.004             ... 3.7
>>>>>> Riboflavin (alone) 0.4          ... 58.7 (perhaps suggesting that
>>>>>> culture media quenches riboflavin or it gets converted in part to
>>>>>> something less fluorescent?) Contact Essen if you want the entire
>>>>>> tech note.
>>>>>>
>>>>>>
>>>>>> If you absolutely require a green fluorescent protein, spend the
>>>>>> time to switch to the new Clover or "V6" from Steven Vogel
>>>>>> (available from addgene.org as VVVVVV).
>>>>>> If you do not need green, switch to tdTomato or the new mRuby2.
>>>>>>
>>>>>>
>>>>>>
>>>>>> Create File
>>>>>> Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. [Epub ahead of
>>>>>> print]
>>>>>>
>>>>>>
>>>>>>  Improving FRET dynamic range with bright green and red
>>>>>> fluorescent proteins.
>>>>>>
>>>>>> Lam AJ (et al)
>>>>>>
>>>>>>      Abstract
>>>>>>
>>>>>> A variety of genetically encoded reporters use changes in
>>>>>> fluorescence resonance energy transfer (FRET) to report on
>>>>>> biochemical processes in living cells. The standard genetically
>>>>>> encoded FRET pair consists of CFPs and YFPs, but many CFP-YFP
>>>>>> reporters suffer from low FRET dynamic range, phototoxicity from
>>>>>> the CFP excitation light and complex photokinetic events such as
>>>>>> reversible photobleaching and photoconversion. We engineered two
>>>>>> fluorescent proteins,* Clover and mRuby2*, which are the brightest
>>>>>> green and red fluorescent proteins to date and have the highest
>>>>>> Förster radius of any ratiometric FRET pair yet described.
>>>>>> Replacement of CFP and YFP with these two proteins in reporters of
>>>>>> kinase activity, small GTPase activity and transmembrane voltage
>>>>>> significantly improves photostability, FRET dynamic range and
>>>>>> emission ratio changes. These improvements enhance detection of
>>>>>> transient biochemical events such as neuronal action-potential
>>>>>> firing and RhoA activation in growth cones.
>>>>>>
>>>>>> PMID:
>>>>>>    22961245
>>>>>>
>>>>>>
>>>>>> PLoS One.<#>  2012;7(5):e38209. Epub 2012 May 30.
>>>>>>
>>>>>>
>>>>>>  Fluorescence polarization and fluctuation analysis monitors
>>>>>> subunit proximity, stoichiometry, and protein complex hydrodynamics.
>>>>>>
>>>>>> Nguyen TA ...  Vogel SS
>>>>>>
>>>>>>      Abstract
>>>>>>
>>>>>> Förster resonance energy transfer (FRET) microscopy is frequently
>>>>>> used to study protein interactions and conformational changes in
>>>>>> living cells. The utility of FRET is limited by false positive and
>>>>>> negative signals. To overcome these limitations we have developed
>>>>>> Fluorescence Polarization and Fluctuation Analysis (FPFA), a hybrid
>>>>>> single-molecule based method combining time-resolved fluorescence
>>>>>> anisotropy (homo-FRET) and fluorescence correlation spectroscopy.
>>>>>> Using FPFA, homo-FRET (a 1-10 nm proximity gauge), brightness (a
>>>>>> measure of the number of fluorescent subunits in a complex), and
>>>>>> correlation time (an attribute sensitive to the mass and shape of a
>>>>>> protein complex) can be simultaneously measured. These
>> measurements
>>>>>> together rigorously constrain the interpretation of FRET signals.
>>>>>> Venus based control-constructs were used to validate FPFA. The
>>>>>> utility of FPFA was demonstrated by measuring in living cells the
>>>>>> number of subunits in the ?-isoform of Venus-tagged
>>>>>> calcium-calmodulin dependent protein kinase-II (CaMKII?)
>> holoenzyme.
>>>>>> Brightness analysis revealed that the holoenzyme has, on average,
>>>>>> 11.9 ± 1.2 subunit, but values ranged from 10-14 in individual
>>>>>>cells.
>>>>>> Homo-FRET analysis simultaneously detected that catalytic domains
>>>>>> were arranged as dimers in the dodecameric holoenzyme, and this
>>>>>> paired organization was confirmed by quantitative hetero-FRET
>>>>>> analysis. In freshly prepared cell homogenates FPFA detected only
>>>>>> 10.2 ± 1.3 subunits in the holoenzyme with values ranging from 9-12.
>>>>>> Despite the reduction in subunit number, catalytic domains were
>>>>>> still arranged as pairs in homogenates. Thus, FPFA suggests that
>>>>>> while the absolute number of subunits in an auto-inhibited
>>>>>> holoenzyme might vary from cell to cell, the organization of
>>>>>> catalytic domains into pairs is preserved.
>>>>>>
>>>>>> PMID:
>>>>>>    22666486
>>>>>>
>>>>>>
>>>>>> I am a bit disappointed Vogel's group did not go for V8 (a well
>>>>>> known
>>>>>> drink) or V12 - the latter either as a polypeptide or with
>>>>>> inducible dimerization domain. V12 since the goal of this paper is
>>>>>> to quantify the number of subunits in CaMKIIalpha, which turns out
>>>>>> to be 12 (+/- a few) as described in
>>>>>> http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3364239/figure/pone-
>> 003
>>>>>> 82
>>>>>> 09-g004/
>>>>>>
>>>>>>
>>>>>> On 9/14/2012 4:32 AM, simon walker wrote:
>>>>>>
>>>>>>> *****
>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>>> *****
>>>>>>>
>>>>>>> Thanks for the various responses.  Yes, I'd seen the Bogdanov
>>>>>>> paper and the Evrogen medium and thought that might be worth a
>>>>>>> try.  The problem we have is that for our assay the culture medium
>>>>>>> is absolutely critical (it's not just a case of keeping cells
>>>>>>> alive), so we can't use a minimal HEPES-based buffer.  I am
>>>>>>> interested to know what is in the 'BackDrop' solution.  We can't
>>>>>>> use it unless we're fairly confident it's not going to affect our
>>>>>>>assay.
>>>>>>> Simon
>>>>>>>
>>>>>>>
>>>>>>> -----Original Message-----
>>>>>>> From: Confocal Microscopy List
>>>>>>> [mailto:[hidden email]] On Behalf Of
>> George
>>>>>>> McNamara
>>>>>>> Sent: 14 September 2012 01:57
>>>>>>> To:[hidden email]
>>>>>>> Subject: Re: Background fluorescence problem
>>>>>>>
>>>>>>> *****
>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>>> *****
>>>>>>>
>>>>>>> Hi Simon,
>>>>>>>
>>>>>>> likely riboflavin and possibly other flavins. See
>>>>>>>
>> http://www.evrogen.com/products/medium_DMEM_gfp/medium_DMEM_
>> gfp.sh
>>>>>>> tm l and the Bogdanov et al paper referenced  at the bottom of the
>>>>>>> page;
>>>>>>>
>>>>>>>      * Bogdanov AM, Bogdanova EA, Chudakov DM, Gorodnicheva TV,
>>>>>>> Lukyanov
>>>>>>>        S, Lukyanov KA. Cell culture medium affects GFP
>>>>>>> photostability: a
>>>>>>>        solution. Nat Methods. 2009; 6 (12):859-60. / pmid:
>>>>>>> 19935837
>>>>>>>
>> <http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Pub
>>>>>>> Me d&list_uids=19935837&dopt=Abstract>
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>> Their solution: incubate cells in miedia without (or with low, if
>>>>>>> needed) riboflavin for a day.
>>>>>>>
>>>>>>> As a bonus, riboflavin quenches (FRET?) and/or transiently
>>>>>>> photoconverts GFP to red fluorescence (might be mostly dark
>>>>>>>states):
>>>>>>>
>>>>>>> Condensed mitotic chromosome structure at nanometer resolution
>>>>>>> using PALM and EGFP- histones.</pubmed/20856676>* Matsuda* A,
>> Shao
>>>>>>> L, Boulanger J, Kervrann C, Carlton PM, Kner P, Agard D, *Sedat*
>>>>>>>JW.
>>>>>>> PLoS One. 2010 Sep 15;5(9):e12768. PMID: 20856676
>>>>>>>
>>>>>>>
>>>>>>> If you contact Essen Biosciences, they will (hopefully) give you a
>>>>>>> copy of their application note on the concentrations of riboflavin
>>>>>>> in many culture media and correlation with fluorescence of those
>>>>>>> media. Speaking of Essen - they finally introduced a dual
>>>>>>> green+red fluorescence Incucyte.
>>>>>>>
>>>>>>> Enjoy,
>>>>>>>
>>>>>>> George
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>> On 9/13/2012 11:04 AM, Simon Walker wrote:
>>>>>>>
>>>>>>>> *****
>>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>>> http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy
>>>>>>>> *****
>>>>>>>>
>>>>>>>> Dear List,
>>>>>>>> We are imaging very weakly fluorescent live cells (expressing
>>>>>>>> GFP) on a wide- field system and having issues with a source of
>>>>>>>> background fluorescence.
>>>>>>>> When we look at our cells under epi-illumination we see a rapid
>>>>>>>> drop in a weak background signal (not where the cells are) that
>>>>>>>> fully recovers over a ~10 s period after the illumination light
>>>>>>>> is switched off.  Our experiments require the use of DMEM as the
>>>>>>>> imaging medium and this is the likely cause of problem.  It
>>>>>>>> appears that something in the medium is sticking to the
>>>>>>>> coverglass.  It's not phenol red as the effect is seen with both
>>>>>>>> phenol red-containing and phenol- red-free DMEM.  Does anyone
>>>>>>>> know what else it could be?  Has anyone else seen anything
>>>>>>>> similar?  We're wondering if it could be riboflavin which is in
>>>>>>>>the
>> DMEM we're using.  Would this stick to glass?
>>>>>>>>
>>>>>>>> I've seen that Life Technologies now market a substance that
>>>>>>>> allegedly surpresses background fluorescence in DMEM:
>>>>>>>> http://products.invitrogen.com/ivgn/product/R37603
>>>>>>>> Has anyone tried this?  Does anyone know how it works?
>>>>>>>>
>>>>>>>> Thanks,
>>>>>>>> Simon
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>> The Babraham Institute, Babraham Research Campus, Cambridge CB22
>>>>>>> 3AT Registered Charity No. 1053902.
>>>>>>> The information transmitted in this email is directed only to the
>>>>>>> addressee. If you received this in error, please contact the
>>>>>>> sender and delete this email from your system. The contents of
>>>>>>> this e-mail are the views of the sender and do not necessarily
>>>>>>> represent the views of the Babraham Institute. Full conditions at:
>>>>>>>
>> www.babraham.ac.uk<http://www.babraham.ac.uk/email_disclaimer.html
>>>
>