http://confocal-microscopy-list.275.s1.nabble.com/Background-fluorescence-problem-tp7579031p7579184.html
I think I'll leave the established sequences as they are. Well: maybe I'll get rid of one or two restriction sites. mRuby2 is a different question, though - I did not make up my mind yet…
I optimized the tdtomato and Gcamp sequences before - it's just extremely tough to judge whether that did any good or not in my case.
PS: I apologise for attributing the Lam et al. mRuby2 / Clover paper incorrectly: Last author is Michael Lin.
> *****
> To join, leave or search the confocal microscopy listserv, go to:
>
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy> *****
>
> We spent sometime designing codon-optimized FPs for expression in C.
> elegans and found, in two out of three cases, that in otherwise equivalent
> transgenic animals, codon-optimized FP expression was severely compromised
> in comparison to the 'established' coding sequences that had been, and
> still are, used in worms since their initial development as reporters. As
> well as being different with respect to codon use our 'codon-optimized'
> sequences had two, unequally spaced artificial introns whereas the
> otherwise equivalent but non 'codon-optimized' coding sequences all had
> three equally spaced introns. We might just have been unlucky but I think
> there are other variables - such as use, number and placement of introns -
> that may as important, if not more so. 'Codon-optimization' may not be the
> only thing to consider and, as such, in some situations it may be a case
> of 'if it aint broke don't fix it'!
>
>
>
> Colin
>
> On 17/10/2012 10:54, "Tobias Rose" <
[hidden email]> wrote:
>
>> *****
>> To join, leave or search the confocal microscopy listserv, go to:
>>
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy>> *****
>>
>> Hi everybody,
>>
>> Sorry to warm up this old thread and please excuse the lengthy post - but
>> I am about to do precisely what George suggested: Synthesize mRuby2.
>> (well: without the publish to addgene and try to snatch citations away
>> from R. Tsien bit...). And by the way: All plasmids from that publication
>> are available on addgene now:
http://www.addgene.org/browse/article/5906/>> .
>> Be aware that there are quite a few tags on the N-terminus of mRuby2...
>>
>> The question that I am asking myself for a while now is:
>> Is codon optimization really worth it?
>>
>> Due to lack of time and to increase turnover I am by now synthesizing
>> most of my DNA. With the breakneck speed that fluorescent proteins and
>> genetically encoded functional indicators are developed right now it's
>> almost impossible to keep up without synthesis. And it¹s also very
>> convenient...
>>
>> However: besides all the PR talk of synthesis companies I don't really
>> know if codon optimization (for mouse in my case) would do more harm than
>> good. For instance, next to all the semi-anecdotal optimization papers
>> out there there is still this Science paper here:
>>
>> Coding-Sequence Determinants of Gene Expression in Escherichia coli
>> Grzegorz Kudla, Andrew W. Murray, David Tollervey, and Joshua B. Plotkin
>> Science 10 April 2009: 324 (5924), 255-258. [DOI:10.1126/science.1170160]
>>
>> At least in e. coli codon usage appears to not matter at all (see also
>> discussion here:
>>
http://omicsomics.blogspot.de/2009/04/is-codon-optimization-bunk.html ).
>>
>> Also, even though I cannot judge it, it's stated in my 'AAV cookbook':
>> "[...It should be noted, however, that the potential for introduction of
>> sequences that negatively affect gene expression is also a risk with this
>> process, and it is difficult to predict which sequences will have such an
>> effect. For example, it has been shown that the sequences coding for
>> protein domain boundaries are more likely to be coded by ³translationally
>> slow² codons [...]"
>> Gray, J. T. & Zolotukhin, S. Adeno-Associated Virus. 807, 2546 (2011).
>>
>> Right now I don't even know if the run of the mill XFPs available from
>> addgene or Tsien himself _are_ in any way codon-optimized away from the
>> original species towards mammalian use.
>>
>> Whould you say that it makes sense, for example, to further 'optimize'
>> very established sequences like standard XFPs (in my case for tdtomato
>> and GCaMPx (genetically-encoded Ca2+ indicator [GFP + calmodulin +
>> M13peptide])? The problem with the CAI score that George posted (next to
>> the fact that that's only one out of many ways to codon optimize) is that
>> I'm getting entirely different CAI scores from different calculators and
>> especially also for different mammalian species (e.g. human vs. mouse -
>> is codon usage really that different here?):
>>
>> Example:
>> mRUBY2 CDS
>>
>> www.jcat.de
>> human
>> before opt:
>> CAI 0.27
>>
>> After opt:
>> CAI 0.95
>>
>> Mouse (my target):
>> before opt
>> CAI 0.23
>>
>> after opt:
>> CAI 0.72
>>
>> Same sequence with genscript:
>>
http://www.genscript.com/cgi-bin/tools/rare_codon_analysis>>
>> human
>> before opt
>> CAI : 0.75
>>
>> Mouse
>> before opt
>> CAI : 0.75
>>
>> As usual, optimisation is proprietary hereŠ and might be biased towards
>> ease of synthesis and not necessary towards best possible expression.
>>
>> And then there is the entirely different optimization from other
>> companies like DNA2.0...
>>
>> What is your opinion: voodoo or not? Would you change 'established'
>> sequences to increase expression - or would you just optimize when you
>> switch species?
>>
>> Thanks,T
>>
>> Also: What's your bet - is mRuby2 the best red/orange protein ever -- or
>> would you still use mCherry or (td)tomato in spite of all the
>> cytotoxicity rumours?
>>
>>
>>
>>
>>
>>
>>> -----Original Message-----
>>> From: Confocal Microscopy List
>>> [mailto:
[hidden email]] On Behalf Of George
>>> McNamara
>>> Sent: Sunday, September 16, 2012 7:21 PM
>>> To:
[hidden email]
>>> Subject: Re: Clover and mRuby2 FPs ... Re: Background fluorescence
>>> problem
>>>
>>> *****
>>> To join, leave or search the confocal microscopy listserv, go to:
>>>
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy>>> *****
>>>
>>>
>>>> Hi Roger,
>>>>
>>>> These are not my FP's! I read the paper a couple of days ago and
>>>> thought it worth mentioning to the listserv.
>>>>
>>>> The paper states that the plasmids will be available at addgene.org -
>>>> presumably (ok, hopefully) in sync with the print edition official
>>>> publication date.
>>>>
>>>> If you are in a hurry, you could contact the PI to try to get the
>>>> plasmids early (i.e. offer to provide your fedex number).
>>>>
>>>> I did not see mRuby in addgene.org either. The original mRuby paper is
>>>> PMID: 19194514.
>>>>
>>>> The mRuby2 DNA sequence is available online at NCBI Nucleotide (search
>>>> term:
http://www.ncbi.nlm.nih.gov/nuccore?term=eqFP611 )
>>>>
>>>> Synthetic construct red fluorescent protein Ruby2 gene, partial cds
>>>> </nuccore/JX489389.1>
>>>>
>>>> 711 bp linear other-genetic
>>>>
>>>> Accession: JX489389.1
>>>> GI: 404332617
>>>>
>>>> atggtgtcta agggcgaaga gctgatcaag gaaaatatgc gtatgaaggt ggtcatggaa 61
>>>> ggttcggtca acggccacca attcaaatgc acaggtgaag gagaaggcaa tccgtacatg 121
>>>> ggaactcaaa ccatgaggat caaagtcatc gagggaggac ccctgccatt tgcctttgac 181
>>>> attcttgcca cgtcgttcat gtatggcagc cgtactttta tcaagtaccc gaaaggcatt 241
>>>> cctgatttct ttaaacagtc ctttcctgag ggttttactt gggaaagagt tacgagatac 301
>>>> gaagatggtg gagtcgtcac cgtcatgcag gacaccagcc ttgaggatgg ctgtctcgtt 361
>>>> taccacgtcc aagtcagagg ggtaaacttt ccctccaatg gtcccgtgat gcagaagaag 421
>>>> accaagggtt gggagcctaa tacagagatg atgtatccag cagatggtgg tctgagggga 481
>>>> tacactcata tggcactgaa agttgatggt ggtggccatc tgtcttgctc tttcgtaaca 541
>>>> acttacaggt caaaaaagac cgtcgggaac atcaagatgc ccggtatcca tgccgttgat 601
>>>> caccgcctgg aaaggttaga ggaaagtgac aatgaaatgt tcgtagtaca acgcgaacac 661
>>>> gcagttgcca agttcgccgg gcttggtggt gggatggacg agctgtacaa g
>>>>
>>>>
>>>> I ran the above mRuby2 DNA sequence through one of the free online
>>>> codon optimization programs - www.jcat.de which gave a low CAI score
>>>> (CAI 0.27) when I asked for human optimization.
>>>>
>>>> jcat recommends (CAI 0.96, a typical optimized score):
>>>>
>>>> ATGGTGAGCAAGGGCGAGGAGCTGATCAAGGAGAACATGCGCATGAAGGT 50
>>>> GGTGATGGAGGGCAGCGTGAACGGCCACCAGTTCAAGTGCACCGGCGAGG 100
>>>> GCGAGGGCAACCCCTACATGGGCACCCAGACCATGCGCATCAAGGTGATC 150
>>>> GAGGGCGGCCCCCTGCCCTTCGCCTTCGACATCCTGGCCACCAGCTTCAT 200
>>>> GTACGGCAGCCGCACCTTCATCAAGTACCCCAAGGGCATCCCCGACTTCT 250
>>>> TCAAGCAGAGCTTCCCCGAGGGCTTCACCTGGGAGCGCGTGACCCGCTAC 300
>>>> GAGGACGGCGGCGTGGTGACCGTGATGCAGGACACCAGCCTGGAGGACGG 350
>>>> CTGCCTGGTGTACCACGTGCAGGTGCGCGGCGTGAACTTCCCCAGCAACG 400
>>>> GCCCCGTGATGCAGAAGAAGACCAAGGGCTGGGAGCCCAACACCGAGATG 450
>>>> ATGTACCCCGCCGACGGCGGCCTGCGCGGCTACACCCACATGGCCCTGAA 500
>>>> GGTGGACGGCGGCGGCCACCTGAGCTGCAGCTTCGTGACCACCTACCGCA 550
>>>> GCAAGAAGACCGTGGGCAACATCAAGATGCCCGGCATCCACGCCGTGGAC 600
>>>> CACCGCCTGGAGCGCCTGGAGGAGAGCGACAACGAGATGTTCGTGGTGCA 650
>>>> GCGCGAGCACGCCGTGGCCAAGTTCGCCGGCCTGGGCGGCGGCATGGACG 700
>>> AGCTGTACAAG
>>>>
>>>>
>>>> Clover sequence is:
>>>>
>>>> Synthetic construct *green* *fluorescent* protein Clover gene, partial
>>>> cds </nuccore/JX489388.1>
>>>>
>>>> 684 bp linear other-genetic
>>>>
>>>> Accession: JX489388.1
>>>> GI: 404332615
>>>>
>>>> their sequence:
>>>>
>>>> 1 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 61
>>>> ggcgacgtaa acggccacaa gttcagcgtc cgcggcgagg gcgagggcga tgccaccaac 121
>>>> ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 181
>>>> ctcgtgacca ccttcggcta cggcgtggcc tgcttcagcc gctaccccga ccacatgaag 241
>>>> cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatctct 301
>>>> ttcaaggacg acggtaccta caagacccgc gccgaggtga agttcgaggg cgacaccctg 361
>>>> gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 421
>>>> aagctggagt acaacttcaa cagccacaac gtctatatca cggccgacaa gcagaagaac 481
>>>> ggcatcaagg ctaacttcaa gatccgccac aacgttgagg acggcagcgt gcagctcgcc 541
>>>> gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 601
>>>> tacctgagcc atcagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 661
>>>> ctgctggagt tcgtaaccgc cgcc
>>>>
>>>> JCat reported a CAI of 0.79 (1.0 being perfect), and recommended: (CAI
>>>> 0.956):
>>>>
>>>> ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGCGTGGTGCCCATCCTGGT 50
>>>> GGAGCTGGACGGCGACGTGAACGGCCACAAGTTCAGCGTGCGCGGCGAGG 100
>>>> GCGAGGGCGACGCCACCAACGGCAAGCTGACCCTGAAGTTCATCTGCACC 150
>>>> ACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTGGTGACCACCTTCGGCTA 200
>>>> CGGCGTGGCCTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACT 250
>>>> TCTTCAAGAGCGCCATGCCCGAGGGCTACGTGCAGGAGCGCACCATCAGC 300
>>>> TTCAAGGACGACGGCACCTACAAGACCCGCGCCGAGGTGAAGTTCGAGGG 350
>>>> CGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG 400
>>>> ACGGCAACATCCTGGGCCACAAGCTGGAGTACAACTTCAACAGCCACAAC 450
>>>> GTGTACATCACCGCCGACAAGCAGAAGAACGGCATCAAGGCCAACTTCAA 500
>>>> GATCCGCCACAACGTGGAGGACGGCAGCGTGCAGCTGGCCGACCACTACC 550
>>>> AGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCAC 600
>>>> TACCTGAGCCACCAGAGCGCCCTGAGCAAGGACCCCAACGAGAAGCGCGA 650
>>>> CCACATGGTGCTGCTGGAGTTCGTGACCGCCGCC
>>>>
>>>>
>>>>
>>>> at 711 bases - each, you might find it cost effective to simply order
>>>> this (or pick your favorite optimizer ... or optimize for your
>>>> favorite organism) sequence from some DNA synthesis company.
>>>>
>>>> If the company charges by the gene, you could stick in a short linker
>>>> (see the paper, or use Steven Vogel's sequence in C5V or in between
>>>> his V's of V6) and have 711+(say)15+711 base sequence synthesized. If
>>>> you posted that plasmid to addgene.org, and mentioned codon optimized
>>>> for human (and maybe stuck on a promoter or maximized Gateway
>>>> compatibility), would probably lead to being your most popular addgene
>>>> construct and (when you publish it) most referenced technical paper.
>>>>
>>>> Enjoy,
>>>>
>>>> George
>>>>
>>>>
>>>> On 9/16/2012 12:28 PM, Roger Phillips wrote:
>>>>> Dear George,
>>>>> Have you looked at lifetime kinetics in the transfer from Clover to
>>> mRuby2? I only have access to the paper copy of Nature Methods so won't
>>> read the details till next month. We are about to shift from fixed to
>>> live cell
>>> imaging and we need to choose labels for [] and []. Are the vectors for
>>> fusion construction and for controls (Clover-mRuby2 tandem construct in
>>> sup fig 9 and unfused Clover and mRuby2 available?
>>>>> Thanks for your work,
>>>>> Roger Phillips
>>>>>
>>>>> Dr Roger Guy Phillips
>>>>> Centre for Advanced Microscopy,
>>>>> University of Sussex
>>>>> School of Life Sciences
>>>>> John Maynard Smith Building
>>>>> Falmer, Brighton& Hove
>>>>> BN1 9QG
>>>>> United Kingdom
>>>>>
>>>>> phone:44 (0)1273 877585
>>>>> fax: 44 (0)1273 678433
>>>>> email:
[hidden email]
>>>>> room:2C9 (ext 7585)/lab 4C2 (ext 2734)
>>>>>
>>>>>
>>>>>
>>>>>
>>>>> -----Original Message-----
>>>>> From: Confocal Microscopy List
>>>>> [mailto:
[hidden email]] On Behalf Of George
>>>>> McNamara
>>>>> Sent: 15 September 2012 01:33
>>>>> To:
[hidden email]
>>>>> Subject: Clover and mRuby2 FPs ... Re: Background fluorescence
>>>>> problem
>>>>>
>>>>> *****
>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy>>>>> *****
>>>>>
>>>>> Hi Kurt,
>>>>>
>>>>> Clover and mruby2 are described in the Lam et al paper at Nature
>>>>> Methods
>>>>>
>>>>>
>>>
http://www.nature.com/nmeth/journal/vaop/ncurrent/full/nmeth.2171.ht>>> m
>>>>> l
>>>>>
>>>>> A variety of genetically encoded reporters use changes in
>>>>> fluorescence (or Förster) resonance energy transfer (FRET) to report
>>> on
>>> biochemical processes in living cells. The standard genetically encoded
>>> FRET
>>> pair consists of CFPs and YFPs, but many CFP-YFP reporters suffer from
>>> low
>>> FRET dynamic range, phototoxicity from the CFP excitation light and
>>> complex photokinetic events such as reversible photobleaching and
>>> photoconversion. We engineered two fluorescent proteins, Clover and
>>> mRuby2, which are the brightest green and red fluorescent proteins to
>>> date
>>> and have the highest Förster radius of any ratiometric FRET pair yet
>>> described. Replacement of CFP and YFP with these two proteins in
>>> reporters
>>> of kinase activity, small GTPase activity and transmembrane voltage
>>> significantly improves photostability, FRET dynamic range and emission
>>> ratio changes. These improvements enhance detection of transient
>>> biochemical events such as neuronal action-potential firing and RhoA act
>>> ivation in growth cones.
>>>>>
>>>>>
>>>>>
>>>>> On 9/14/2012 2:58 PM, Kurt Thorn wrote:
>>>>>
>>>>>> *****
>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy>>>>>> *****
>>>>>>
>>>>>> What is Clover GFP? I can't find much information about it on
>>> Google.
>>>>>>
>>>>>> Thanks,
>>>>>> Kurt
>>>>>>
>>>>>> On 9/14/2012 3:49 AM, George McNamara wrote:
>>>>>>
>>>>>>> *****
>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>>
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy>>>>>>> *****
>>>>>>>
>>>>>>> Hi Simon,
>>>>>>>
>>>>>>> Your cells might not need the 100x excess of riboflavin present in
>>>>>>> "standard" DMEM, your background could be reduced. The Essen tech
>>>>>>> note I mentioned lists:
>>>>>>> DMEM 0.4 mg/L riboflavin ... 43.6 units fluorescence
>>>>>>> Eagles MEM 0.1 mg/mL ... 12.9
>>>>>>> F12K 0.04 ... 5.4
>>>>>>> EBM 0.004 ... 3.7
>>>>>>> Riboflavin (alone) 0.4 ... 58.7 (perhaps suggesting that
>>>>>>> culture media quenches riboflavin or it gets converted in part to
>>>>>>> something less fluorescent?) Contact Essen if you want the entire
>>>>>>> tech note.
>>>>>>>
>>>>>>>
>>>>>>> If you absolutely require a green fluorescent protein, spend the
>>>>>>> time to switch to the new Clover or "V6" from Steven Vogel
>>>>>>> (available from addgene.org as VVVVVV).
>>>>>>> If you do not need green, switch to tdTomato or the new mRuby2.
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>> Create File
>>>>>>> Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. [Epub ahead of
>>>>>>> print]
>>>>>>>
>>>>>>>
>>>>>>> Improving FRET dynamic range with bright green and red
>>>>>>> fluorescent proteins.
>>>>>>>
>>>>>>> Lam AJ (et al)
>>>>>>>
>>>>>>> Abstract
>>>>>>>
>>>>>>> A variety of genetically encoded reporters use changes in
>>>>>>> fluorescence resonance energy transfer (FRET) to report on
>>>>>>> biochemical processes in living cells. The standard genetically
>>>>>>> encoded FRET pair consists of CFPs and YFPs, but many CFP-YFP
>>>>>>> reporters suffer from low FRET dynamic range, phototoxicity from
>>>>>>> the CFP excitation light and complex photokinetic events such as
>>>>>>> reversible photobleaching and photoconversion. We engineered two
>>>>>>> fluorescent proteins,* Clover and mRuby2*, which are the brightest
>>>>>>> green and red fluorescent proteins to date and have the highest
>>>>>>> Förster radius of any ratiometric FRET pair yet described.
>>>>>>> Replacement of CFP and YFP with these two proteins in reporters of
>>>>>>> kinase activity, small GTPase activity and transmembrane voltage
>>>>>>> significantly improves photostability, FRET dynamic range and
>>>>>>> emission ratio changes. These improvements enhance detection of
>>>>>>> transient biochemical events such as neuronal action-potential
>>>>>>> firing and RhoA activation in growth cones.
>>>>>>>
>>>>>>> PMID:
>>>>>>> 22961245
>>>>>>>
>>>>>>>
>>>>>>> PLoS One.<#> 2012;7(5):e38209. Epub 2012 May 30.
>>>>>>>
>>>>>>>
>>>>>>> Fluorescence polarization and fluctuation analysis monitors
>>>>>>> subunit proximity, stoichiometry, and protein complex
>>> hydrodynamics.
>>>>>>>
>>>>>>> Nguyen TA ... Vogel SS
>>>>>>>
>>>>>>> Abstract
>>>>>>>
>>>>>>> Förster resonance energy transfer (FRET) microscopy is frequently
>>>>>>> used to study protein interactions and conformational changes in
>>>>>>> living cells. The utility of FRET is limited by false positive and
>>>>>>> negative signals. To overcome these limitations we have developed
>>>>>>> Fluorescence Polarization and Fluctuation Analysis (FPFA), a hybrid
>>>>>>> single-molecule based method combining time-resolved fluorescence
>>>>>>> anisotropy (homo-FRET) and fluorescence correlation spectroscopy.
>>>>>>> Using FPFA, homo-FRET (a 1-10 nm proximity gauge), brightness (a
>>>>>>> measure of the number of fluorescent subunits in a complex), and
>>>>>>> correlation time (an attribute sensitive to the mass and shape of a
>>>>>>> protein complex) can be simultaneously measured. These
>>> measurements
>>>>>>> together rigorously constrain the interpretation of FRET signals.
>>>>>>> Venus based control-constructs were used to validate FPFA. The
>>>>>>> utility of FPFA was demonstrated by measuring in living cells the
>>>>>>> number of subunits in the ?-isoform of Venus-tagged
>>>>>>> calcium-calmodulin dependent protein kinase-II (CaMKII?)
>>> holoenzyme.
>>>>>>> Brightness analysis revealed that the holoenzyme has, on average,
>>>>>>> 11.9 ± 1.2 subunit, but values ranged from 10-14 in individual
>>> cells.
>>>>>>> Homo-FRET analysis simultaneously detected that catalytic domains
>>>>>>> were arranged as dimers in the dodecameric holoenzyme, and this
>>>>>>> paired organization was confirmed by quantitative hetero-FRET
>>>>>>> analysis. In freshly prepared cell homogenates FPFA detected only
>>>>>>> 10.2 ± 1.3 subunits in the holoenzyme with values ranging from
>>> 9-12.
>>>>>>> Despite the reduction in subunit number, catalytic domains were
>>>>>>> still arranged as pairs in homogenates. Thus, FPFA suggests that
>>>>>>> while the absolute number of subunits in an auto-inhibited
>>>>>>> holoenzyme might vary from cell to cell, the organization of
>>>>>>> catalytic domains into pairs is preserved.
>>>>>>>
>>>>>>> PMID:
>>>>>>> 22666486
>>>>>>>
>>>>>>>
>>>>>>> I am a bit disappointed Vogel's group did not go for V8 (a well
>>>>>>> known
>>>>>>> drink) or V12 - the latter either as a polypeptide or with
>>>>>>> inducible dimerization domain. V12 since the goal of this paper is
>>>>>>> to quantify the number of subunits in CaMKIIalpha, which turns out
>>>>>>> to be 12 (+/- a few) as described in
>>>>>>>
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3364239/figure/pone->>> 003
>>>>>>> 82
>>>>>>> 09-g004/
>>>>>>>
>>>>>>>
>>>>>>> On 9/14/2012 4:32 AM, simon walker wrote:
>>>>>>>
>>>>>>>> *****
>>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>>>
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy>>>>>>>> *****
>>>>>>>>
>>>>>>>> Thanks for the various responses. Yes, I'd seen the Bogdanov
>>>>>>>> paper and the Evrogen medium and thought that might be worth a
>>>>>>>> try. The problem we have is that for our assay the culture medium
>>>>>>>> is absolutely critical (it's not just a case of keeping cells
>>>>>>>> alive), so we can't use a minimal HEPES-based buffer. I am
>>>>>>>> interested to know what is in the 'BackDrop' solution. We can't
>>>>>>>> use it unless we're fairly confident it's not going to affect our
>>> assay.
>>>>>>>> Simon
>>>>>>>>
>>>>>>>>
>>>>>>>> -----Original Message-----
>>>>>>>> From: Confocal Microscopy List
>>>>>>>> [mailto:
[hidden email]] On Behalf Of
>>> George
>>>>>>>> McNamara
>>>>>>>> Sent: 14 September 2012 01:57
>>>>>>>> To:
[hidden email]
>>>>>>>> Subject: Re: Background fluorescence problem
>>>>>>>>
>>>>>>>> *****
>>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>>>
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy>>>>>>>> *****
>>>>>>>>
>>>>>>>> Hi Simon,
>>>>>>>>
>>>>>>>> likely riboflavin and possibly other flavins. See
>>>>>>>>
>>>
http://www.evrogen.com/products/medium_DMEM_gfp/medium_DMEM_>>> gfp.sh
>>>>>>>> tm l and the Bogdanov et al paper referenced at the bottom of the
>>>>>>>> page;
>>>>>>>>
>>>>>>>> * Bogdanov AM, Bogdanova EA, Chudakov DM, Gorodnicheva TV,
>>>>>>>> Lukyanov
>>>>>>>> S, Lukyanov KA. Cell culture medium affects GFP
>>>>>>>> photostability: a
>>>>>>>> solution. Nat Methods. 2009; 6 (12):859-60. / pmid:
>>>>>>>> 19935837
>>>>>>>>
>>> <
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Pub>>>>>>>> Me d&list_uids=19935837&dopt=Abstract>
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>> Their solution: incubate cells in miedia without (or with low, if
>>>>>>>> needed) riboflavin for a day.
>>>>>>>>
>>>>>>>> As a bonus, riboflavin quenches (FRET?) and/or transiently
>>>>>>>> photoconverts GFP to red fluorescence (might be mostly dark
>>> states):
>>>>>>>>
>>>>>>>> Condensed mitotic chromosome structure at nanometer resolution
>>>>>>>> using PALM and EGFP- histones.</pubmed/20856676>* Matsuda* A,
>>> Shao
>>>>>>>> L, Boulanger J, Kervrann C, Carlton PM, Kner P, Agard D, *Sedat*
>>> JW.
>>>>>>>> PLoS One. 2010 Sep 15;5(9):e12768. PMID: 20856676
>>>>>>>>
>>>>>>>>
>>>>>>>> If you contact Essen Biosciences, they will (hopefully) give you a
>>>>>>>> copy of their application note on the concentrations of riboflavin
>>>>>>>> in many culture media and correlation with fluorescence of those
>>>>>>>> media. Speaking of Essen - they finally introduced a dual
>>>>>>>> green+red fluorescence Incucyte.
>>>>>>>>
>>>>>>>> Enjoy,
>>>>>>>>
>>>>>>>> George
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>> On 9/13/2012 11:04 AM, Simon Walker wrote:
>>>>>>>>
>>>>>>>>> *****
>>>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>>>>
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy>>>>>>>>> *****
>>>>>>>>>
>>>>>>>>> Dear List,
>>>>>>>>> We are imaging very weakly fluorescent live cells (expressing
>>>>>>>>> GFP) on a wide- field system and having issues with a source of
>>>>>>>>> background fluorescence.
>>>>>>>>> When we look at our cells under epi-illumination we see a rapid
>>>>>>>>> drop in a weak background signal (not where the cells are) that
>>>>>>>>> fully recovers over a ~10 s period after the illumination light
>>>>>>>>> is switched off. Our experiments require the use of DMEM as the
>>>>>>>>> imaging medium and this is the likely cause of problem. It
>>>>>>>>> appears that something in the medium is sticking to the
>>>>>>>>> coverglass. It's not phenol red as the effect is seen with both
>>>>>>>>> phenol red-containing and phenol- red-free DMEM. Does anyone
>>>>>>>>> know what else it could be? Has anyone else seen anything
>>>>>>>>> similar? We're wondering if it could be riboflavin which is in
>>> the
>>> DMEM we're using. Would this stick to glass?
>>>>>>>>>
>>>>>>>>> I've seen that Life Technologies now market a substance that
>>>>>>>>> allegedly surpresses background fluorescence in DMEM:
>>>>>>>>>
http://products.invitrogen.com/ivgn/product/R37603>>>>>>>>> Has anyone tried this? Does anyone know how it works?
>>>>>>>>>
>>>>>>>>> Thanks,
>>>>>>>>> Simon
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>> The Babraham Institute, Babraham Research Campus, Cambridge CB22
>>>>>>>> 3AT Registered Charity No. 1053902.
>>>>>>>> The information transmitted in this email is directed only to the
>>>>>>>> addressee. If you received this in error, please contact the
>>>>>>>> sender and delete this email from your system. The contents of
>>>>>>>> this e-mail are the views of the sender and do not necessarily
>>>>>>>> represent the views of the Babraham Institute. Full conditions at:
>>>>>>>>
>>> www.babraham.ac.uk<
http://www.babraham.ac.uk/email_disclaimer.html>>>>
>>
>>
>>> -----Original Message-----
>>> From: Confocal Microscopy List
>>> [mailto:
[hidden email]] On Behalf Of George
>>> McNamara
>>> Sent: Sunday, September 16, 2012 7:21 PM
>>> To:
[hidden email]
>>> Subject: Re: Clover and mRuby2 FPs ... Re: Background fluorescence
>>> problem
>>>
>>> *****
>>> To join, leave or search the confocal microscopy listserv, go to:
>>>
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy>>> *****
>>>
>>>
>>>> Hi Roger,
>>>>
>>>> These are not my FP's! I read the paper a couple of days ago and
>>>> thought it worth mentioning to the listserv.
>>>>
>>>> The paper states that the plasmids will be available at addgene.org -
>>>> presumably (ok, hopefully) in sync with the print edition official
>>>> publication date.
>>>>
>>>> If you are in a hurry, you could contact the PI to try to get the
>>>> plasmids early (i.e. offer to provide your fedex number).
>>>>
>>>> I did not see mRuby in addgene.org either. The original mRuby paper is
>>>> PMID: 19194514.
>>>>
>>>> The mRuby2 DNA sequence is available online at NCBI Nucleotide (search
>>>> term:
http://www.ncbi.nlm.nih.gov/nuccore?term=eqFP611 )
>>>>
>>>> Synthetic construct red fluorescent protein Ruby2 gene, partial cds
>>>> </nuccore/JX489389.1>
>>>>
>>>> 711 bp linear other-genetic
>>>>
>>>> Accession: JX489389.1
>>>> GI: 404332617
>>>>
>>>> atggtgtcta agggcgaaga gctgatcaag gaaaatatgc gtatgaaggt ggtcatggaa 61
>>>> ggttcggtca acggccacca attcaaatgc acaggtgaag gagaaggcaa tccgtacatg 121
>>>> ggaactcaaa ccatgaggat caaagtcatc gagggaggac ccctgccatt tgcctttgac 181
>>>> attcttgcca cgtcgttcat gtatggcagc cgtactttta tcaagtaccc gaaaggcatt 241
>>>> cctgatttct ttaaacagtc ctttcctgag ggttttactt gggaaagagt tacgagatac 301
>>>> gaagatggtg gagtcgtcac cgtcatgcag gacaccagcc ttgaggatgg ctgtctcgtt 361
>>>> taccacgtcc aagtcagagg ggtaaacttt ccctccaatg gtcccgtgat gcagaagaag 421
>>>> accaagggtt gggagcctaa tacagagatg atgtatccag cagatggtgg tctgagggga 481
>>>> tacactcata tggcactgaa agttgatggt ggtggccatc tgtcttgctc tttcgtaaca 541
>>>> acttacaggt caaaaaagac cgtcgggaac atcaagatgc ccggtatcca tgccgttgat 601
>>>> caccgcctgg aaaggttaga ggaaagtgac aatgaaatgt tcgtagtaca acgcgaacac 661
>>>> gcagttgcca agttcgccgg gcttggtggt gggatggacg agctgtacaa g
>>>>
>>>>
>>>> I ran the above mRuby2 DNA sequence through one of the free online
>>>> codon optimization programs - www.jcat.de which gave a low CAI score
>>>> (CAI 0.27) when I asked for human optimization.
>>>>
>>>> jcat recommends (CAI 0.96, a typical optimized score):
>>>>
>>>> ATGGTGAGCAAGGGCGAGGAGCTGATCAAGGAGAACATGCGCATGAAGGT 50
>>>> GGTGATGGAGGGCAGCGTGAACGGCCACCAGTTCAAGTGCACCGGCGAGG 100
>>>> GCGAGGGCAACCCCTACATGGGCACCCAGACCATGCGCATCAAGGTGATC 150
>>>> GAGGGCGGCCCCCTGCCCTTCGCCTTCGACATCCTGGCCACCAGCTTCAT 200
>>>> GTACGGCAGCCGCACCTTCATCAAGTACCCCAAGGGCATCCCCGACTTCT 250
>>>> TCAAGCAGAGCTTCCCCGAGGGCTTCACCTGGGAGCGCGTGACCCGCTAC 300
>>>> GAGGACGGCGGCGTGGTGACCGTGATGCAGGACACCAGCCTGGAGGACGG 350
>>>> CTGCCTGGTGTACCACGTGCAGGTGCGCGGCGTGAACTTCCCCAGCAACG 400
>>>> GCCCCGTGATGCAGAAGAAGACCAAGGGCTGGGAGCCCAACACCGAGATG 450
>>>> ATGTACCCCGCCGACGGCGGCCTGCGCGGCTACACCCACATGGCCCTGAA 500
>>>> GGTGGACGGCGGCGGCCACCTGAGCTGCAGCTTCGTGACCACCTACCGCA 550
>>>> GCAAGAAGACCGTGGGCAACATCAAGATGCCCGGCATCCACGCCGTGGAC 600
>>>> CACCGCCTGGAGCGCCTGGAGGAGAGCGACAACGAGATGTTCGTGGTGCA 650
>>>> GCGCGAGCACGCCGTGGCCAAGTTCGCCGGCCTGGGCGGCGGCATGGACG 700
>>> AGCTGTACAAG
>>>>
>>>>
>>>> Clover sequence is:
>>>>
>>>> Synthetic construct *green* *fluorescent* protein Clover gene, partial
>>>> cds </nuccore/JX489388.1>
>>>>
>>>> 684 bp linear other-genetic
>>>>
>>>> Accession: JX489388.1
>>>> GI: 404332615
>>>>
>>>> their sequence:
>>>>
>>>> 1 atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt cgagctggac 61
>>>> ggcgacgtaa acggccacaa gttcagcgtc cgcggcgagg gcgagggcga tgccaccaac 121
>>>> ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc ctggcccacc 181
>>>> ctcgtgacca ccttcggcta cggcgtggcc tgcttcagcc gctaccccga ccacatgaag 241
>>>> cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg caccatctct 301
>>>> ttcaaggacg acggtaccta caagacccgc gccgaggtga agttcgaggg cgacaccctg 361
>>>> gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat cctggggcac 421
>>>> aagctggagt acaacttcaa cagccacaac gtctatatca cggccgacaa gcagaagaac 481
>>>> ggcatcaagg ctaacttcaa gatccgccac aacgttgagg acggcagcgt gcagctcgcc 541
>>>> gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc cgacaaccac 601
>>>> tacctgagcc atcagtccgc cctgagcaaa gaccccaacg agaagcgcga tcacatggtc 661
>>>> ctgctggagt tcgtaaccgc cgcc
>>>>
>>>> JCat reported a CAI of 0.79 (1.0 being perfect), and recommended: (CAI
>>>> 0.956):
>>>>
>>>> ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGCGTGGTGCCCATCCTGGT 50
>>>> GGAGCTGGACGGCGACGTGAACGGCCACAAGTTCAGCGTGCGCGGCGAGG 100
>>>> GCGAGGGCGACGCCACCAACGGCAAGCTGACCCTGAAGTTCATCTGCACC 150
>>>> ACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTGGTGACCACCTTCGGCTA 200
>>>> CGGCGTGGCCTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACT 250
>>>> TCTTCAAGAGCGCCATGCCCGAGGGCTACGTGCAGGAGCGCACCATCAGC 300
>>>> TTCAAGGACGACGGCACCTACAAGACCCGCGCCGAGGTGAAGTTCGAGGG 350
>>>> CGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGG 400
>>>> ACGGCAACATCCTGGGCCACAAGCTGGAGTACAACTTCAACAGCCACAAC 450
>>>> GTGTACATCACCGCCGACAAGCAGAAGAACGGCATCAAGGCCAACTTCAA 500
>>>> GATCCGCCACAACGTGGAGGACGGCAGCGTGCAGCTGGCCGACCACTACC 550
>>>> AGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCAC 600
>>>> TACCTGAGCCACCAGAGCGCCCTGAGCAAGGACCCCAACGAGAAGCGCGA 650
>>>> CCACATGGTGCTGCTGGAGTTCGTGACCGCCGCC
>>>>
>>>>
>>>>
>>>> at 711 bases - each, you might find it cost effective to simply order
>>>> this (or pick your favorite optimizer ... or optimize for your
>>>> favorite organism) sequence from some DNA synthesis company.
>>>>
>>>> If the company charges by the gene, you could stick in a short linker
>>>> (see the paper, or use Steven Vogel's sequence in C5V or in between
>>>> his V's of V6) and have 711+(say)15+711 base sequence synthesized. If
>>>> you posted that plasmid to addgene.org, and mentioned codon optimized
>>>> for human (and maybe stuck on a promoter or maximized Gateway
>>>> compatibility), would probably lead to being your most popular addgene
>>>> construct and (when you publish it) most referenced technical paper.
>>>>
>>>> Enjoy,
>>>>
>>>> George
>>>>
>>>>
>>>> On 9/16/2012 12:28 PM, Roger Phillips wrote:
>>>>> Dear George,
>>>>> Have you looked at lifetime kinetics in the transfer from Clover to
>>> mRuby2? I only have access to the paper copy of Nature Methods so won't
>>> read the details till next month. We are about to shift from fixed to
>>> live cell
>>> imaging and we need to choose labels for [] and []. Are the vectors for
>>> fusion construction and for controls (Clover-mRuby2 tandem construct in
>>> sup fig 9 and unfused Clover and mRuby2 available?
>>>>> Thanks for your work,
>>>>> Roger Phillips
>>>>>
>>>>> Dr Roger Guy Phillips
>>>>> Centre for Advanced Microscopy,
>>>>> University of Sussex
>>>>> School of Life Sciences
>>>>> John Maynard Smith Building
>>>>> Falmer, Brighton& Hove
>>>>> BN1 9QG
>>>>> United Kingdom
>>>>>
>>>>> phone:44 (0)1273 877585
>>>>> fax: 44 (0)1273 678433
>>>>> email:
[hidden email]
>>>>> room:2C9 (ext 7585)/lab 4C2 (ext 2734)
>>>>>
>>>>>
>>>>>
>>>>>
>>>>> -----Original Message-----
>>>>> From: Confocal Microscopy List
>>>>> [mailto:
[hidden email]] On Behalf Of George
>>>>> McNamara
>>>>> Sent: 15 September 2012 01:33
>>>>> To:
[hidden email]
>>>>> Subject: Clover and mRuby2 FPs ... Re: Background fluorescence
>>>>> problem
>>>>>
>>>>> *****
>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy>>>>> *****
>>>>>
>>>>> Hi Kurt,
>>>>>
>>>>> Clover and mruby2 are described in the Lam et al paper at Nature
>>>>> Methods
>>>>>
>>>>>
>>>
http://www.nature.com/nmeth/journal/vaop/ncurrent/full/nmeth.2171.ht>>> m
>>>>> l
>>>>>
>>>>> A variety of genetically encoded reporters use changes in
>>>>> fluorescence (or Förster) resonance energy transfer (FRET) to report
>>>>> on
>>> biochemical processes in living cells. The standard genetically encoded
>>> FRET
>>> pair consists of CFPs and YFPs, but many CFP-YFP reporters suffer from
>>> low
>>> FRET dynamic range, phototoxicity from the CFP excitation light and
>>> complex photokinetic events such as reversible photobleaching and
>>> photoconversion. We engineered two fluorescent proteins, Clover and
>>> mRuby2, which are the brightest green and red fluorescent proteins to
>>> date
>>> and have the highest Förster radius of any ratiometric FRET pair yet
>>> described. Replacement of CFP and YFP with these two proteins in
>>> reporters
>>> of kinase activity, small GTPase activity and transmembrane voltage
>>> significantly improves photostability, FRET dynamic range and emission
>>> ratio changes. These improvements enhance detection of transient
>>> biochemical events such as neuronal action-potential firing and RhoA act
>>> ivation in growth cones.
>>>>>
>>>>>
>>>>>
>>>>> On 9/14/2012 2:58 PM, Kurt Thorn wrote:
>>>>>
>>>>>> *****
>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy>>>>>> *****
>>>>>>
>>>>>> What is Clover GFP? I can't find much information about it on Google.
>>>>>>
>>>>>> Thanks,
>>>>>> Kurt
>>>>>>
>>>>>> On 9/14/2012 3:49 AM, George McNamara wrote:
>>>>>>
>>>>>>> *****
>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>>
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy>>>>>>> *****
>>>>>>>
>>>>>>> Hi Simon,
>>>>>>>
>>>>>>> Your cells might not need the 100x excess of riboflavin present in
>>>>>>> "standard" DMEM, your background could be reduced. The Essen tech
>>>>>>> note I mentioned lists:
>>>>>>> DMEM 0.4 mg/L riboflavin ... 43.6 units fluorescence
>>>>>>> Eagles MEM 0.1 mg/mL ... 12.9
>>>>>>> F12K 0.04 ... 5.4
>>>>>>> EBM 0.004 ... 3.7
>>>>>>> Riboflavin (alone) 0.4 ... 58.7 (perhaps suggesting that
>>>>>>> culture media quenches riboflavin or it gets converted in part to
>>>>>>> something less fluorescent?) Contact Essen if you want the entire
>>>>>>> tech note.
>>>>>>>
>>>>>>>
>>>>>>> If you absolutely require a green fluorescent protein, spend the
>>>>>>> time to switch to the new Clover or "V6" from Steven Vogel
>>>>>>> (available from addgene.org as VVVVVV).
>>>>>>> If you do not need green, switch to tdTomato or the new mRuby2.
>>>>>>>
>>>>>>>
>>>>>>>
>>>>>>> Create File
>>>>>>> Nat Methods. 2012 Sep 9. doi: 10.1038/nmeth.2171. [Epub ahead of
>>>>>>> print]
>>>>>>>
>>>>>>>
>>>>>>> Improving FRET dynamic range with bright green and red
>>>>>>> fluorescent proteins.
>>>>>>>
>>>>>>> Lam AJ (et al)
>>>>>>>
>>>>>>> Abstract
>>>>>>>
>>>>>>> A variety of genetically encoded reporters use changes in
>>>>>>> fluorescence resonance energy transfer (FRET) to report on
>>>>>>> biochemical processes in living cells. The standard genetically
>>>>>>> encoded FRET pair consists of CFPs and YFPs, but many CFP-YFP
>>>>>>> reporters suffer from low FRET dynamic range, phototoxicity from
>>>>>>> the CFP excitation light and complex photokinetic events such as
>>>>>>> reversible photobleaching and photoconversion. We engineered two
>>>>>>> fluorescent proteins,* Clover and mRuby2*, which are the brightest
>>>>>>> green and red fluorescent proteins to date and have the highest
>>>>>>> Förster radius of any ratiometric FRET pair yet described.
>>>>>>> Replacement of CFP and YFP with these two proteins in reporters of
>>>>>>> kinase activity, small GTPase activity and transmembrane voltage
>>>>>>> significantly improves photostability, FRET dynamic range and
>>>>>>> emission ratio changes. These improvements enhance detection of
>>>>>>> transient biochemical events such as neuronal action-potential
>>>>>>> firing and RhoA activation in growth cones.
>>>>>>>
>>>>>>> PMID:
>>>>>>> 22961245
>>>>>>>
>>>>>>>
>>>>>>> PLoS One.<#> 2012;7(5):e38209. Epub 2012 May 30.
>>>>>>>
>>>>>>>
>>>>>>> Fluorescence polarization and fluctuation analysis monitors
>>>>>>> subunit proximity, stoichiometry, and protein complex hydrodynamics.
>>>>>>>
>>>>>>> Nguyen TA ... Vogel SS
>>>>>>>
>>>>>>> Abstract
>>>>>>>
>>>>>>> Förster resonance energy transfer (FRET) microscopy is frequently
>>>>>>> used to study protein interactions and conformational changes in
>>>>>>> living cells. The utility of FRET is limited by false positive and
>>>>>>> negative signals. To overcome these limitations we have developed
>>>>>>> Fluorescence Polarization and Fluctuation Analysis (FPFA), a hybrid
>>>>>>> single-molecule based method combining time-resolved fluorescence
>>>>>>> anisotropy (homo-FRET) and fluorescence correlation spectroscopy.
>>>>>>> Using FPFA, homo-FRET (a 1-10 nm proximity gauge), brightness (a
>>>>>>> measure of the number of fluorescent subunits in a complex), and
>>>>>>> correlation time (an attribute sensitive to the mass and shape of a
>>>>>>> protein complex) can be simultaneously measured. These
>>> measurements
>>>>>>> together rigorously constrain the interpretation of FRET signals.
>>>>>>> Venus based control-constructs were used to validate FPFA. The
>>>>>>> utility of FPFA was demonstrated by measuring in living cells the
>>>>>>> number of subunits in the ?-isoform of Venus-tagged
>>>>>>> calcium-calmodulin dependent protein kinase-II (CaMKII?)
>>> holoenzyme.
>>>>>>> Brightness analysis revealed that the holoenzyme has, on average,
>>>>>>> 11.9 ± 1.2 subunit, but values ranged from 10-14 in individual
>>>>>>> cells.
>>>>>>> Homo-FRET analysis simultaneously detected that catalytic domains
>>>>>>> were arranged as dimers in the dodecameric holoenzyme, and this
>>>>>>> paired organization was confirmed by quantitative hetero-FRET
>>>>>>> analysis. In freshly prepared cell homogenates FPFA detected only
>>>>>>> 10.2 ± 1.3 subunits in the holoenzyme with values ranging from 9-12.
>>>>>>> Despite the reduction in subunit number, catalytic domains were
>>>>>>> still arranged as pairs in homogenates. Thus, FPFA suggests that
>>>>>>> while the absolute number of subunits in an auto-inhibited
>>>>>>> holoenzyme might vary from cell to cell, the organization of
>>>>>>> catalytic domains into pairs is preserved.
>>>>>>>
>>>>>>> PMID:
>>>>>>> 22666486
>>>>>>>
>>>>>>>
>>>>>>> I am a bit disappointed Vogel's group did not go for V8 (a well
>>>>>>> known
>>>>>>> drink) or V12 - the latter either as a polypeptide or with
>>>>>>> inducible dimerization domain. V12 since the goal of this paper is
>>>>>>> to quantify the number of subunits in CaMKIIalpha, which turns out
>>>>>>> to be 12 (+/- a few) as described in
>>>>>>>
http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3364239/figure/pone->>> 003
>>>>>>> 82
>>>>>>> 09-g004/
>>>>>>>
>>>>>>>
>>>>>>> On 9/14/2012 4:32 AM, simon walker wrote:
>>>>>>>
>>>>>>>> *****
>>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>>>
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy>>>>>>>> *****
>>>>>>>>
>>>>>>>> Thanks for the various responses. Yes, I'd seen the Bogdanov
>>>>>>>> paper and the Evrogen medium and thought that might be worth a
>>>>>>>> try. The problem we have is that for our assay the culture medium
>>>>>>>> is absolutely critical (it's not just a case of keeping cells
>>>>>>>> alive), so we can't use a minimal HEPES-based buffer. I am
>>>>>>>> interested to know what is in the 'BackDrop' solution. We can't
>>>>>>>> use it unless we're fairly confident it's not going to affect our
>>>>>>>> assay.
>>>>>>>> Simon
>>>>>>>>
>>>>>>>>
>>>>>>>> -----Original Message-----
>>>>>>>> From: Confocal Microscopy List
>>>>>>>> [mailto:
[hidden email]] On Behalf Of
>>> George
>>>>>>>> McNamara
>>>>>>>> Sent: 14 September 2012 01:57
>>>>>>>> To:
[hidden email]
>>>>>>>> Subject: Re: Background fluorescence problem
>>>>>>>>
>>>>>>>> *****
>>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>>>
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy>>>>>>>> *****
>>>>>>>>
>>>>>>>> Hi Simon,
>>>>>>>>
>>>>>>>> likely riboflavin and possibly other flavins. See
>>>>>>>>
>>>
http://www.evrogen.com/products/medium_DMEM_gfp/medium_DMEM_>>> gfp.sh
>>>>>>>> tm l and the Bogdanov et al paper referenced at the bottom of the
>>>>>>>> page;
>>>>>>>>
>>>>>>>> * Bogdanov AM, Bogdanova EA, Chudakov DM, Gorodnicheva TV,
>>>>>>>> Lukyanov
>>>>>>>> S, Lukyanov KA. Cell culture medium affects GFP
>>>>>>>> photostability: a
>>>>>>>> solution. Nat Methods. 2009; 6 (12):859-60. / pmid:
>>>>>>>> 19935837
>>>>>>>>
>>> <
http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=Pub>>>>>>>> Me d&list_uids=19935837&dopt=Abstract>
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>> Their solution: incubate cells in miedia without (or with low, if
>>>>>>>> needed) riboflavin for a day.
>>>>>>>>
>>>>>>>> As a bonus, riboflavin quenches (FRET?) and/or transiently
>>>>>>>> photoconverts GFP to red fluorescence (might be mostly dark
>>>>>>>> states):
>>>>>>>>
>>>>>>>> Condensed mitotic chromosome structure at nanometer resolution
>>>>>>>> using PALM and EGFP- histones.</pubmed/20856676>* Matsuda* A,
>>> Shao
>>>>>>>> L, Boulanger J, Kervrann C, Carlton PM, Kner P, Agard D, *Sedat*
>>>>>>>> JW.
>>>>>>>> PLoS One. 2010 Sep 15;5(9):e12768. PMID: 20856676
>>>>>>>>
>>>>>>>>
>>>>>>>> If you contact Essen Biosciences, they will (hopefully) give you a
>>>>>>>> copy of their application note on the concentrations of riboflavin
>>>>>>>> in many culture media and correlation with fluorescence of those
>>>>>>>> media. Speaking of Essen - they finally introduced a dual
>>>>>>>> green+red fluorescence Incucyte.
>>>>>>>>
>>>>>>>> Enjoy,
>>>>>>>>
>>>>>>>> George
>>>>>>>>
>>>>>>>>
>>>>>>>>
>>>>>>>> On 9/13/2012 11:04 AM, Simon Walker wrote:
>>>>>>>>
>>>>>>>>> *****
>>>>>>>>> To join, leave or search the confocal microscopy listserv, go to:
>>>>>>>>>
http://lists.umn.edu/cgi-bin/wa?A0=confocalmicroscopy>>>>>>>>> *****
>>>>>>>>>
>>>>>>>>> Dear List,
>>>>>>>>> We are imaging very weakly fluorescent live cells (expressing
>>>>>>>>> GFP) on a wide- field system and having issues with a source of
>>>>>>>>> background fluorescence.
>>>>>>>>> When we look at our cells under epi-illumination we see a rapid
>>>>>>>>> drop in a weak background signal (not where the cells are) that
>>>>>>>>> fully recovers over a ~10 s period after the illumination light
>>>>>>>>> is switched off. Our experiments require the use of DMEM as the
>>>>>>>>> imaging medium and this is the likely cause of problem. It
>>>>>>>>> appears that something in the medium is sticking to the
>>>>>>>>> coverglass. It's not phenol red as the effect is seen with both
>>>>>>>>> phenol red-containing and phenol- red-free DMEM. Does anyone
>>>>>>>>> know what else it could be? Has anyone else seen anything
>>>>>>>>> similar? We're wondering if it could be riboflavin which is in
>>>>>>>>> the
>>> DMEM we're using. Would this stick to glass?
>>>>>>>>>
>>>>>>>>> I've seen that Life Technologies now market a substance that
>>>>>>>>> allegedly surpresses background fluorescence in DMEM:
>>>>>>>>>
http://products.invitrogen.com/ivgn/product/R37603>>>>>>>>> Has anyone tried this? Does anyone know how it works?
>>>>>>>>>
>>>>>>>>> Thanks,
>>>>>>>>> Simon
>>>>>>>>>
>>>>>>>>>
>>>>>>>>>
>>>>>>>> The Babraham Institute, Babraham Research Campus, Cambridge CB22
>>>>>>>> 3AT Registered Charity No. 1053902.
>>>>>>>> The information transmitted in this email is directed only to the
>>>>>>>> addressee. If you received this in error, please contact the
>>>>>>>> sender and delete this email from your system. The contents of
>>>>>>>> this e-mail are the views of the sender and do not necessarily
>>>>>>>> represent the views of the Babraham Institute. Full conditions at:
>>>>>>>>
>>> www.babraham.ac.uk<
http://www.babraham.ac.uk/email_disclaimer.html>>>>
>>